Transcript: Human NM_001352607.2

Homo sapiens propionyl-CoA carboxylase subunit alpha (PCCA), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
PCCA (5095)
Length:
2265
CDS:
29..1996

Additional Resources:

NCBI RefSeq record:
NM_001352607.2
NBCI Gene record:
PCCA (5095)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001352607.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421850 ATTACTTCGAGAGGTGATAAT pLKO_005 1399 CDS 100% 13.200 18.480 N PCCA n/a
2 TRCN0000078427 GCAGTTGAATGTCGGGTTTAT pLKO.1 1133 CDS 100% 13.200 18.480 N PCCA n/a
3 TRCN0000339286 GCAGTTGAATGTCGGGTTTAT pLKO_005 1133 CDS 100% 13.200 18.480 N Pcca n/a
4 TRCN0000412740 GCTTTCACACACAATTGATTC pLKO_005 2049 3UTR 100% 10.800 15.120 N PCCA n/a
5 TRCN0000078425 GCGACAAGATTGAAAGCAAAT pLKO.1 474 CDS 100% 10.800 7.560 N PCCA n/a
6 TRCN0000078424 CCAGGAAGTGATATTAGCATT pLKO.1 1259 CDS 100% 4.950 3.465 N PCCA n/a
7 TRCN0000078426 GCAGGTGGAAACATGAGCATT pLKO.1 1811 CDS 100% 4.950 3.465 N PCCA n/a
8 TRCN0000078423 CGTCATATAGAAATCCAGGTT pLKO.1 752 CDS 100% 2.640 1.848 N PCCA n/a
9 TRCN0000112466 CGAAACTAAATGTGACCAGTA pLKO.1 1713 CDS 100% 4.050 3.240 N Pcca n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001352607.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11018 pDONR223 100% 86.4% 86.5% None (many diffs) n/a
2 ccsbBroad304_11018 pLX_304 0% 86.4% 86.5% V5 (many diffs) n/a
3 TRCN0000477380 CACATGCGCCTAGGTGTCCATTCG pLX_317 21.2% 86.4% 86.5% V5 (many diffs) n/a
Download CSV