Transcript: Human NM_001352804.2

Homo sapiens transforming acidic coiled-coil containing protein 1 (TACC1), transcript variant 31, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
TACC1 (6867)
Length:
6080
CDS:
59..1075

Additional Resources:

NCBI RefSeq record:
NM_001352804.2
NBCI Gene record:
TACC1 (6867)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001352804.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000154853 GCCAAAGTGTAGATAGCCTTT pLKO.1 3968 3UTR 100% 4.050 5.670 N TACC1 n/a
2 TRCN0000275915 GCCAAAGTGTAGATAGCCTTT pLKO_005 3968 3UTR 100% 4.050 5.670 N TACC1 n/a
3 TRCN0000157354 CCACGTCATGTGGTCAGAAAT pLKO.1 276 CDS 100% 13.200 9.240 N TACC1 n/a
4 TRCN0000275917 CCACGTCATGTGGTCAGAAAT pLKO_005 276 CDS 100% 13.200 9.240 N TACC1 n/a
5 TRCN0000155998 CAGGATTACTTAGCCAGAGTT pLKO.1 806 CDS 100% 4.950 3.465 N TACC1 n/a
6 TRCN0000155270 GACAAGTATGACCTCTCAGAA pLKO.1 631 CDS 100% 4.950 3.465 N TACC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001352804.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11168 pDONR223 100% 45.3% 43.5% None (many diffs) n/a
2 ccsbBroad304_11168 pLX_304 0% 45.3% 43.5% V5 (many diffs) n/a
3 TRCN0000478540 TGCCTAACGCTTCCGTTGCCGGAC pLX_317 16.1% 45.3% 43.5% V5 (many diffs) n/a
Download CSV