Transcript: Human NM_001352899.1

Homo sapiens arylsulfatase G (ARSG), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-19
Taxon:
Homo sapiens (human)
Gene:
ARSG (22901)
Length:
2999
CDS:
626..2203

Additional Resources:

NCBI RefSeq record:
NM_001352899.1
NBCI Gene record:
ARSG (22901)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001352899.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358764 GTTACGTCACTGGGATAATAG pLKO_005 1011 CDS 100% 13.200 18.480 N ARSG n/a
2 TRCN0000051347 CACGCAACTTTGCAGTCACTT pLKO.1 933 CDS 100% 4.950 6.930 N ARSG n/a
3 TRCN0000358697 CAACATCTCCAGCGCAGATTA pLKO_005 2113 CDS 100% 13.200 9.240 N ARSG n/a
4 TRCN0000358699 CTACTTTGGAATCCCATATAG pLKO_005 1090 CDS 100% 13.200 9.240 N ARSG n/a
5 TRCN0000358698 ATGGAGTCACACGCAACTTTG pLKO_005 924 CDS 100% 10.800 7.560 N ARSG n/a
6 TRCN0000051346 CCTCTGGTTTACAGGAGACAA pLKO.1 1513 CDS 100% 4.950 3.465 N ARSG n/a
7 TRCN0000051343 CCTGCTGTAATCCCTACCAAA pLKO.1 2157 CDS 100% 4.950 3.465 N ARSG n/a
8 TRCN0000051344 GCAGCATAAGTTTCCTCTGAT pLKO.1 1969 CDS 100% 4.950 3.465 N ARSG n/a
9 TRCN0000051345 CCAACCTTGATAAGATGGCTT pLKO.1 810 CDS 100% 2.640 1.848 N ARSG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001352899.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02699 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02699 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469774 ACAAAAGAGATATGAGTGGAACCG pLX_317 25.2% 100% 100% V5 n/a
4 ccsbBroadEn_14999 pDONR223 0% 100% 100% None n/a
5 ccsbBroad304_14999 pLX_304 0% 100% 100% V5 n/a
6 TRCN0000466305 CGATAGACTCGCTCTCTATTGGCC pLX_317 18.6% 100% 100% V5 n/a
Download CSV