Transcript: Human NM_001353418.2

Homo sapiens GRB2 related adaptor protein like (GRAPL), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
GRAPL (400581)
Length:
1193
CDS:
32..382

Additional Resources:

NCBI RefSeq record:
NM_001353418.2
NBCI Gene record:
GRAPL (400581)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001353418.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255649 TGCATCCAAGTCGCATCCGTA pLKO_005 446 3UTR 100% 2.640 2.112 N GRAPL n/a
2 TRCN0000255647 CTTCCGTCAAGCACCCATTTA pLKO_005 648 3UTR 100% 13.200 9.240 N GRAPL n/a
3 TRCN0000255651 GCTGCTGCAGAGACCAAGTTT pLKO_005 507 3UTR 100% 5.625 3.938 N GRAPL n/a
4 TRCN0000255650 CCTCACCAAGCACTTCCATTT pLKO_005 606 3UTR 100% 10.800 6.480 N GRAPL n/a
5 TRCN0000107169 AGACACACTCAAGATCCTGAA pLKO.1 97 CDS 100% 4.050 2.025 Y GRAP n/a
6 TRCN0000107166 CAAGAACTACATCCGCGTCAA pLKO.1 178 CDS 100% 4.050 2.025 Y GRAP n/a
7 TRCN0000097066 GATGACCAGAACTGGTACAAA pLKO.1 125 CDS 100% 5.625 2.813 Y Grap n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001353418.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05634 pDONR223 100% 98.3% 97.4% None 299_300insTAACAG n/a
2 ccsbBroad304_05634 pLX_304 0% 98.3% 97.4% V5 299_300insTAACAG n/a
3 ccsbBroadEn_15726 pDONR223 0% 48.2% 43.2% None (many diffs) n/a
4 ccsbBroad304_15726 pLX_304 0% 48.2% 43.2% V5 (many diffs) n/a
Download CSV