Transcript: Human NM_001353693.1

Homo sapiens TIAM Rac1 associated GEF 1 (TIAM1), transcript variant 11, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TIAM1 (7074)
Length:
7647
CDS:
922..5697

Additional Resources:

NCBI RefSeq record:
NM_001353693.1
NBCI Gene record:
TIAM1 (7074)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001353693.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000256949 ACAACCCTGACTGCGACATTT pLKO_005 3176 CDS 100% 13.200 18.480 N TIAM1 n/a
2 TRCN0000039656 CGCACCTACGTGAAGGATTTA pLKO.1 4078 CDS 100% 13.200 18.480 N TIAM1 n/a
3 TRCN0000256946 TTCGAAGGCTGTACGTGAATA pLKO_005 3530 CDS 100% 13.200 18.480 N TIAM1 n/a
4 TRCN0000039653 CCGTAGAGAATGTGTGTAGAT pLKO.1 5712 3UTR 100% 4.950 6.930 N TIAM1 n/a
5 TRCN0000018357 TAGATACTTCCTGCCCTAACT pLKO.1 5728 3UTR 100% 4.950 6.930 N TIAM1 n/a
6 TRCN0000256948 TAGTAGCTTTAGGAGTTATAT pLKO_005 7105 3UTR 100% 15.000 10.500 N TIAM1 n/a
7 TRCN0000039657 CGGAATTTGGTGTCTGATATT pLKO.1 1693 CDS 100% 13.200 9.240 N TIAM1 n/a
8 TRCN0000267657 GCTTGAGAAGGTTGATCAATT pLKO_005 4263 CDS 100% 13.200 9.240 N TIAM1 n/a
9 TRCN0000256947 TGAGATTCTTGAGATCAATAA pLKO_005 3600 CDS 100% 13.200 9.240 N TIAM1 n/a
10 TRCN0000010447 CAGCATTCCTATACATCCAAT pLKO.1 1366 CDS 100% 4.950 3.465 N TIAM1 n/a
11 TRCN0000009870 GACATCAAGGAGACAGACATC pLKO.1 5413 CDS 100% 4.050 2.835 N TIAM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001353693.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000476458 CAACCAGGCTTTAGGCAGGCCGTC pLX_317 7.4% 99.8% 99.7% V5 (many diffs) n/a
Download CSV