Transcript: Human NM_001353797.2

Homo sapiens amyloid beta precursor protein binding family A member 2 (APBA2), transcript variant 12, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
APBA2 (321)
Length:
2887
CDS:
380..1705

Additional Resources:

NCBI RefSeq record:
NM_001353797.2
NBCI Gene record:
APBA2 (321)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001353797.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425029 GGTCACCACGGTCCTTATCAA pLKO_005 1423 CDS 100% 5.625 7.875 N APBA2 n/a
2 TRCN0000431146 TCATCGACGGGATCATCTTTG pLKO_005 588 CDS 100% 10.800 7.560 N APBA2 n/a
3 TRCN0000417705 AGAGTCACAGAACAAATGTTT pLKO_005 1898 3UTR 100% 5.625 3.938 N APBA2 n/a
4 TRCN0000427562 CAACACCCAGGAGATGTACAA pLKO_005 1096 CDS 100% 4.950 3.465 N APBA2 n/a
5 TRCN0000436680 CCACGTTCTGGACTGTCTTCT pLKO_005 1945 3UTR 100% 4.950 3.465 N APBA2 n/a
6 TRCN0000063877 TCTGATCTCAATGGACCTGTT pLKO.1 482 CDS 100% 4.050 2.835 N APBA2 n/a
7 TRCN0000430294 TGCGTACCATCTCCTACATCG pLKO_005 816 CDS 100% 4.050 2.835 N APBA2 n/a
8 TRCN0000063873 CCACTTCTCAAACTCGGAGAA pLKO.1 1129 CDS 100% 0.405 0.284 N APBA2 n/a
9 TRCN0000063874 CCAGAAGGAATACAGCGACAT pLKO.1 1072 CDS 100% 4.050 2.430 N APBA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001353797.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05830 pDONR223 100% 58.8% 57.6% None (many diffs) n/a
2 ccsbBroad304_05830 pLX_304 0% 58.8% 57.6% V5 (many diffs) n/a
3 TRCN0000477800 GTGCTTAGGGTTCGAATAACGTTA pLX_317 8.5% 58.8% 57.6% V5 (many diffs) n/a
Download CSV