Transcript: Human NM_001353893.1

Homo sapiens SH3 domain containing kinase binding protein 1 (SH3KBP1), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
SH3KBP1 (30011)
Length:
4436
CDS:
89..1984

Additional Resources:

NCBI RefSeq record:
NM_001353893.1
NBCI Gene record:
SH3KBP1 (30011)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001353893.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418974 TGAAAGTTGGCGACATCATAG pLKO_005 267 CDS 100% 10.800 15.120 N SH3KBP1 n/a
2 TRCN0000038019 CACAACACAAATTCCATCCAA pLKO.1 2130 3UTR 100% 3.000 2.400 N SH3KBP1 n/a
3 TRCN0000423295 AGTTACTTCCACCGGACTTTG pLKO_005 957 CDS 100% 10.800 7.560 N SH3KBP1 n/a
4 TRCN0000038020 CCCTCACATCTTCATCCCTTT pLKO.1 1470 CDS 100% 4.050 2.835 N SH3KBP1 n/a
5 TRCN0000038022 CCAGCAGAAACGAGAGATTAA pLKO.1 1870 CDS 100% 13.200 7.920 N SH3KBP1 n/a
6 TRCN0000038023 GCAGGACAAAGAGCAAGGATT pLKO.1 777 CDS 100% 4.950 2.970 N SH3KBP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001353893.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08160 pDONR223 100% 87.7% 87.6% None 0_1ins177;343_417del;1607C>T n/a
2 ccsbBroad304_08160 pLX_304 0% 87.7% 87.6% V5 0_1ins177;343_417del;1607C>T n/a
3 TRCN0000475526 GGACACTCCTACTCCAAGGCTAAA pLX_317 7% 87.7% 87.6% V5 0_1ins177;343_417del;1607C>T n/a
Download CSV