Transcript: Human NM_001354169.2

Homo sapiens potassium inwardly rectifying channel subfamily J member 5 (KCNJ5), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
KCNJ5 (3762)
Length:
6157
CDS:
466..1725

Additional Resources:

NCBI RefSeq record:
NM_001354169.2
NBCI Gene record:
KCNJ5 (3762)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001354169.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005599 GCTCGTCTTCACCATGGTTTA pLKO.1 735 CDS 100% 10.800 15.120 N KCNJ5 n/a
2 TRCN0000414443 TTACCTGATGAGAGCTCAAAC pLKO_005 2149 3UTR 100% 10.800 8.640 N KCNJ5 n/a
3 TRCN0000429543 AGATCCATCCATATCACATAG pLKO_005 2209 3UTR 100% 10.800 7.560 N KCNJ5 n/a
4 TRCN0000431708 GAGTTAAGATCCATCCATATC pLKO_005 2203 3UTR 100% 10.800 7.560 N KCNJ5 n/a
5 TRCN0000010951 CAGCTGCATCAGGAAGAGTTT pLKO.1 1342 CDS 100% 4.950 3.465 N KCNJ5 n/a
6 TRCN0000005598 GTCTCATTAGAGTGACTCTTA pLKO.1 2377 3UTR 100% 4.950 3.465 N KCNJ5 n/a
7 TRCN0000010949 ACAGACATCAACGTGGGCTTT pLKO.1 1228 CDS 100% 4.050 2.835 N KCNJ5 n/a
8 TRCN0000010950 GACCGAAACAACCATTGGGTA pLKO.1 900 CDS 100% 2.640 1.848 N KCNJ5 n/a
9 TRCN0000430397 CCATCACCTTGTCCCTCATTC pLKO_005 2089 3UTR 100% 10.800 6.480 N KCNJ5 n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 44 5UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001354169.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06477 pDONR223 100% 99.6% 99.7% None (many diffs) n/a
2 ccsbBroad304_06477 pLX_304 0% 99.6% 99.7% V5 (many diffs) n/a
3 TRCN0000476437 CTCAGTTTATGAGATTATTAGAGC pLX_317 30.7% 99.6% 99.7% V5 (many diffs) n/a
Download CSV