Transcript: Human NM_001354219.2

Homo sapiens EH domain binding protein 1 (EHBP1), transcript variant 12, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
EHBP1 (23301)
Length:
5102
CDS:
636..4115

Additional Resources:

NCBI RefSeq record:
NM_001354219.2
NBCI Gene record:
EHBP1 (23301)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001354219.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294399 CATAGGAATTTCCCGATTATT pLKO_005 2069 CDS 100% 15.000 21.000 N EHBP1 n/a
2 TRCN0000294445 CACTTACTCTGTTACCTAAAT pLKO_005 4581 3UTR 100% 13.200 9.240 N EHBP1 n/a
3 TRCN0000306287 GATCTCCGGACTGAACGATTA pLKO_005 3378 CDS 100% 10.800 7.560 N Ehbp1 n/a
4 TRCN0000034295 GCCTTAATAAGGAGAATGAAT pLKO.1 3801 CDS 100% 5.625 3.938 N EHBP1 n/a
5 TRCN0000034296 CCAGATAAACTGGTGGTAGTT pLKO.1 744 CDS 100% 4.950 3.465 N EHBP1 n/a
6 TRCN0000286990 CCAGATAAACTGGTGGTAGTT pLKO_005 744 CDS 100% 4.950 3.465 N EHBP1 n/a
7 TRCN0000034294 CCAGTTTACAAAGACAGTCTT pLKO.1 4803 3UTR 100% 4.950 3.465 N EHBP1 n/a
8 TRCN0000034297 CCAGATCCTTAGAATGCAGAT pLKO.1 2749 CDS 100% 4.050 2.835 N EHBP1 n/a
9 TRCN0000287057 CCAGATCCTTAGAATGCAGAT pLKO_005 2749 CDS 100% 4.050 2.835 N EHBP1 n/a
10 TRCN0000034298 CCGAAGAAGAAGATGAGCATT pLKO.1 4027 CDS 100% 4.950 2.970 N EHBP1 n/a
11 TRCN0000287056 CCGAAGAAGAAGATGAGCATT pLKO_005 4027 CDS 100% 4.950 2.970 N EHBP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001354219.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11715 pDONR223 100% 9% 9% None (many diffs) n/a
2 ccsbBroad304_11715 pLX_304 0% 9% 9% V5 (many diffs) n/a
3 TRCN0000473421 CTCTCTCTTATGAGCTGAGAACAT pLX_317 93.4% 9% 9% V5 (many diffs) n/a
Download CSV