Transcript: Human NM_001354304.2

Homo sapiens phenylalanine hydroxylase (PAH), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
PAH (5053)
Length:
3987
CDS:
343..1701

Additional Resources:

NCBI RefSeq record:
NM_001354304.2
NBCI Gene record:
PAH (5053)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001354304.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056610 GCCAAAGTATTGCGCTTATTT pLKO.1 487 CDS 100% 15.000 21.000 N PAH n/a
2 TRCN0000412430 TCGCATTTCATCAAGATTAAT pLKO_005 1972 3UTR 100% 15.000 21.000 N PAH n/a
3 TRCN0000435532 CCATGAGCTTTCACGAGATAA pLKO_005 660 CDS 100% 13.200 18.480 N PAH n/a
4 TRCN0000056608 CGGAAGCAGTTTGCTGACATT pLKO.1 814 CDS 100% 4.950 3.960 N PAH n/a
5 TRCN0000412463 ACTCATAAAGGAGCATATAAG pLKO_005 2042 3UTR 100% 13.200 9.240 N PAH n/a
6 TRCN0000433552 TCTAGACCTTCTCGTTTAAAG pLKO_005 541 CDS 100% 13.200 9.240 N PAH n/a
7 TRCN0000056609 GCAAACAAGGAGACTCCATAA pLKO.1 1343 CDS 100% 10.800 7.560 N PAH n/a
8 TRCN0000056612 CCATTAACAGTGAAATTGGAA pLKO.1 1649 CDS 100% 3.000 2.100 N PAH n/a
9 TRCN0000056611 CGAGTGGAATACATGGAGGAA pLKO.1 868 CDS 100% 2.640 1.848 N PAH n/a
10 TRCN0000096419 CGCCTGCTGCTGCTGCTGCAA pLKO.1 9 5UTR 100% 0.000 0.000 Y Gsc2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001354304.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06685 pDONR223 100% 99.8% 99.7% None 108A>G;548A>G n/a
2 ccsbBroad304_06685 pLX_304 0% 99.8% 99.7% V5 108A>G;548A>G n/a
3 TRCN0000473451 TCCATCCACTCCCCCTTCTAACAA pLX_317 33.9% 99.8% 99.7% V5 108A>G;548A>G n/a
Download CSV