Transcript: Human NM_001354323.1

Homo sapiens RALY RNA binding protein like (RALYL), transcript variant 25, mRNA.

Source:
NCBI, updated 2018-07-01
Taxon:
Homo sapiens (human)
Gene:
RALYL (138046)
Length:
2021
CDS:
334..1080

Additional Resources:

NCBI RefSeq record:
NM_001354323.1
NBCI Gene record:
RALYL (138046)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001354323.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432652 TGATTTCTACAATCGGTTATT pLKO_005 771 CDS 100% 13.200 18.480 N RALYL n/a
2 TRCN0000074365 CCATGAAAGGTGGATCGAGAT pLKO.1 893 CDS 100% 4.050 5.670 N RALYL n/a
3 TRCN0000074364 CGGCAATCTAAATACGGCAAT pLKO.1 447 CDS 100% 4.050 5.670 N RALYL n/a
4 TRCN0000430519 GTTTCACTGTTGATCATATAT pLKO_005 1418 3UTR 100% 15.000 10.500 N RALYL n/a
5 TRCN0000413772 AGTGGGTCAACAGGTTCTAAA pLKO_005 922 CDS 100% 13.200 9.240 N RALYL n/a
6 TRCN0000074363 GCAGCATCTTTGGTTCAATTT pLKO.1 1161 3UTR 100% 13.200 9.240 N RALYL n/a
7 TRCN0000074366 TGTTCCGTTCACAAAGGTTAT pLKO.1 523 CDS 100% 10.800 7.560 N RALYL n/a
8 TRCN0000421463 TTCCTGTCTGTTGGCGGTTAT pLKO_005 724 CDS 100% 10.800 7.560 N RALYL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001354323.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04914 pDONR223 100% 76.5% 75.3% None (many diffs) n/a
2 ccsbBroad304_04914 pLX_304 0% 76.5% 75.3% V5 (many diffs) n/a
3 TRCN0000481554 CGAAGTCCTTGCTTCCGCCAACTT pLX_317 49% 76.5% 75.3% V5 (many diffs) n/a
Download CSV