Transcript: Human NM_001354601.3

Homo sapiens isovaleryl-CoA dehydrogenase (IVD), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
IVD (3712)
Length:
1702
CDS:
34..1488

Additional Resources:

NCBI RefSeq record:
NM_001354601.3
NBCI Gene record:
IVD (3712)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001354601.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000330975 GTCGGCAGTATGTCTACAATG pLKO_005 1040 CDS 100% 10.800 15.120 N IVD n/a
2 TRCN0000026519 GACGATGCAATCAATGGGCTA pLKO.1 139 CDS 100% 2.160 3.024 N IVD n/a
3 TRCN0000331036 TCTAACACCTGTGAGCTAATC pLKO_005 775 CDS 100% 10.800 7.560 N IVD n/a
4 TRCN0000026588 CAGGCTCTGATGTTGTCTCTA pLKO.1 539 CDS 100% 4.950 3.465 N IVD n/a
5 TRCN0000026587 CACAGCCTTCATTGTGGAGAA pLKO.1 699 CDS 100% 4.050 2.835 N IVD n/a
6 TRCN0000331034 CACAGCCTTCATTGTGGAGAA pLKO_005 699 CDS 100% 4.050 2.835 N IVD n/a
7 TRCN0000026505 GAGTTCAAGAACCTGCGAGAA pLKO.1 250 CDS 100% 4.050 2.835 N IVD n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001354601.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10434 pDONR223 98.9% 81% 78% None (many diffs) n/a
2 ccsbBroad304_10434 pLX_304 0% 81% 78% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV