Transcript: Human NM_001354622.1

Homo sapiens mutL homolog 1 (MLH1), transcript variant 15, mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
MLH1 (4292)
Length:
2795
CDS:
1355..2602

Additional Resources:

NCBI RefSeq record:
NM_001354622.1
NBCI Gene record:
MLH1 (4292)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001354622.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000040054 GCCTGATCTATACAAAGTCTT pLKO.1 2569 CDS 100% 4.950 6.930 N MLH1 n/a
2 TRCN0000288662 GCCTGATCTATACAAAGTCTT pLKO_005 2569 CDS 100% 4.950 6.930 N MLH1 n/a
3 TRCN0000040053 GTGTTCTTCTTTCTCTGTATT pLKO.1 2629 3UTR 100% 13.200 9.240 N MLH1 n/a
4 TRCN0000288641 GTGTTCTTCTTTCTCTGTATT pLKO_005 2629 3UTR 100% 13.200 9.240 N MLH1 n/a
5 TRCN0000040056 CCAAGTGAAGAATATGGGAAA pLKO.1 930 5UTR 100% 4.050 2.835 N MLH1 n/a
6 TRCN0000288642 CCAAGTGAAGAATATGGGAAA pLKO_005 930 5UTR 100% 4.050 2.835 N MLH1 n/a
7 TRCN0000040057 CCTCAGTAAAGAATGCGCTAT pLKO.1 2356 CDS 100% 4.050 2.835 N MLH1 n/a
8 TRCN0000288661 CCTCAGTAAAGAATGCGCTAT pLKO_005 2356 CDS 100% 4.050 2.835 N MLH1 n/a
9 TRCN0000010380 GAAGTTGATTCAGATCCAAGA pLKO.1 593 5UTR 100% 4.050 2.835 N MLH1 n/a
10 TRCN0000010381 TATTCCATCCGGAAGCAGTAC pLKO.1 2381 CDS 100% 4.050 2.835 N MLH1 n/a
11 TRCN0000040055 GCAGACTATTTCTCTTTGGAA pLKO.1 2198 CDS 100% 3.000 2.100 N MLH1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001354622.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01019 pDONR223 100% 54.8% 54.8% None 0_1ins1023 n/a
2 ccsbBroad304_01019 pLX_304 0% 54.8% 54.8% V5 0_1ins1023 n/a
3 TRCN0000489469 ACCTGGAAGACTAAACTACCCCCC pLX_317 15.6% 54.8% 54.8% V5 (not translated due to prior stop codon) 0_1ins1023;1245_1246insTTG n/a
Download CSV