Transcript: Human NM_001354644.1

Homo sapiens membrane metalloendopeptidase (MME), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-07-29
Taxon:
Homo sapiens (human)
Gene:
MME (4311)
Length:
1343
CDS:
467..709

Additional Resources:

NCBI RefSeq record:
NM_001354644.1
NBCI Gene record:
MME (4311)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001354644.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046827 GCAAGTCATCAGACTGCATAA pLKO.1 636 CDS 100% 10.800 7.560 N MME n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001354644.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01020 pDONR223 100% 9.8% 8.8% None (many diffs) n/a
2 ccsbBroad304_01020 pLX_304 0% 9.8% 8.8% V5 (many diffs) n/a
3 TRCN0000475807 TGAGCATTCACCCTCACACGGAAA pLX_317 12% 9.8% 8.8% V5 (many diffs) n/a
Download CSV