Transcript: Human NM_001354998.2

Homo sapiens solute carrier family 35 member E3 (SLC35E3), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-24
Taxon:
Homo sapiens (human)
Gene:
SLC35E3 (55508)
Length:
1309
CDS:
203..1003

Additional Resources:

NCBI RefSeq record:
NM_001354998.2
NBCI Gene record:
SLC35E3 (55508)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001354998.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043711 GCCAAACAGCATGAATTACAA pLKO.1 725 CDS 100% 5.625 3.938 N SLC35E3 n/a
2 TRCN0000043709 GCTTTGCTTATGGTGCTGCTA pLKO.1 869 CDS 100% 2.640 1.848 N SLC35E3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001354998.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03598 pDONR223 100% 84% 81.4% None (many diffs) n/a
2 ccsbBroad304_03598 pLX_304 0% 84% 81.4% V5 (many diffs) n/a
3 TRCN0000473034 CTCTTACCGCGGATAGGTAGGCTT pLX_317 54.5% 84% 81.4% V5 (many diffs) n/a
Download CSV