Transcript: Human NM_001355008.2

Homo sapiens MMP24-AS1-EDEM2 readthrough (MMP24-AS1-EDEM2), mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
MMP24-AS1-EDEM2 (111089941)
Length:
2363
CDS:
681..2294

Additional Resources:

NCBI RefSeq record:
NM_001355008.2
NBCI Gene record:
MMP24-AS1-EDEM2 (111089941)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001355008.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000342980 CAAACGGAGCAGGTCGAAATT pLKO_005 2081 CDS 100% 13.200 6.600 Y EDEM2 n/a
2 TRCN0000369425 CACTTCGGCCAGAACTTATTG pLKO_005 1660 CDS 100% 13.200 6.600 Y EDEM2 n/a
3 TRCN0000055969 CCTAGAGTATAACAAAGCCAT pLKO.1 1397 CDS 100% 2.640 1.320 Y EDEM2 n/a
4 TRCN0000298248 CCTAGAGTATAACAAAGCCAT pLKO_005 1397 CDS 100% 2.640 1.320 Y EDEM2 n/a
5 TRCN0000055970 GAAACAAACATTCGAGTGGTA pLKO.1 906 CDS 100% 2.640 1.320 Y EDEM2 n/a
6 TRCN0000055968 GCTTCAGGATAAGAAGCTCAT pLKO.1 1367 CDS 100% 0.405 0.203 Y EDEM2 n/a
7 TRCN0000055972 GCCATATGGAACAGTGAACTT pLKO.1 1070 CDS 100% 0.000 0.000 Y EDEM2 n/a
8 TRCN0000286597 GCCATATGGAACAGTGAACTT pLKO_005 1070 CDS 100% 0.000 0.000 Y EDEM2 n/a
9 TRCN0000055971 GCTCCCGGAATTCTACAACAT pLKO.1 1601 CDS 100% 0.000 0.000 Y EDEM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001355008.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08575 pDONR223 100% 92.8% 92.7% None 0_1ins123;1243G>A n/a
2 ccsbBroad304_08575 pLX_304 0% 92.8% 92.7% V5 0_1ins123;1243G>A n/a
3 TRCN0000467820 CCCCACCAGAACCCCCGATCTGTC pLX_317 17.2% 92.8% 92.7% V5 0_1ins123;1243G>A n/a
Download CSV