Transcript: Human NM_001355281.1

Homo sapiens Nanog homeobox retrogene P8 (NANOGP8), mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
NANOGP8 (388112)
Length:
1999
CDS:
299..1216

Additional Resources:

NCBI RefSeq record:
NM_001355281.1
NBCI Gene record:
NANOGP8 (388112)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001355281.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436615 AGATGAGTGAAACTGATATTA pLKO_005 1217 CDS 100% 15.000 7.500 Y NANOG n/a
2 TRCN0000429188 ACAGCAGACCACTAGGTATTT pLKO_005 1129 CDS 100% 13.200 6.600 Y NANOG n/a
3 TRCN0000004887 CCTGGAACAGTCCCTTCTATA pLKO.1 1002 CDS 100% 13.200 6.600 Y NANOG n/a
4 TRCN0000420670 GAGTATGGTTGGAGCCTAATC pLKO_005 1368 3UTR 100% 10.800 5.400 Y NANOG n/a
5 TRCN0000004888 CCTAAACTACTCCATGAACAT pLKO.1 1177 CDS 100% 4.950 2.475 Y NANOG n/a
6 TRCN0000004886 CTGTAAAGAATCTTCACCTAT pLKO.1 352 CDS 100% 4.950 2.475 Y NANOG n/a
7 TRCN0000021409 GCTGCCTTCAAGCATCTGTTT pLKO.1 64 5UTR 100% 4.950 2.475 Y NEK5 n/a
8 TRCN0000161379 GCATCTGTTTAACAAAGCACA pLKO.1 75 5UTR 100% 2.640 1.320 Y LOC389286 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001355281.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08987 pDONR223 100% 99.8% 99.6% None 47A>C n/a
2 ccsbBroad304_08987 pLX_304 50.8% 99.8% 99.6% V5 47A>C n/a
3 TRCN0000474074 TCTCAATATACGGCGGTAAGTGCG pLX_317 44.6% 99.8% 99.6% V5 47A>C n/a
Download CSV