Transcript: Human NM_001356505.1

Homo sapiens CRYZL2P-SEC16B readthrough (CRYZL2P-SEC16B), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
CRYZL2P-SEC16B (111240474)
Length:
5302
CDS:
1047..4232

Additional Resources:

NCBI RefSeq record:
NM_001356505.1
NBCI Gene record:
CRYZL2P-SEC16B (111240474)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001356505.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147017 CAGGTGTATAAGCTCCTTTAT pLKO.1 2925 CDS 100% 13.200 6.600 Y SEC16B n/a
2 TRCN0000130014 GACCAATACATGGCTCTATTT pLKO.1 4677 3UTR 100% 13.200 6.600 Y SEC16B n/a
3 TRCN0000127747 GCTGCTAGACCACGAAGTATT pLKO.1 3627 CDS 100% 13.200 6.600 Y SEC16B n/a
4 TRCN0000149186 CCAGGTGTATAAGCTCCTTTA pLKO.1 2924 CDS 100% 10.800 5.400 Y SEC16B n/a
5 TRCN0000146822 CAAATCCTTCATCCCTTCTTT pLKO.1 2903 CDS 100% 5.625 2.813 Y SEC16B n/a
6 TRCN0000150039 CACGAAGTATTTCTGAGAGTT pLKO.1 3637 CDS 100% 4.950 2.475 Y SEC16B n/a
7 TRCN0000148895 CCCACTTCCAATCTAACAGTA pLKO.1 1570 CDS 100% 4.950 2.475 Y SEC16B n/a
8 TRCN0000130820 GCTGCTCTACTATGGAAGGAA pLKO.1 2387 CDS 100% 3.000 1.500 Y SEC16B n/a
9 TRCN0000130892 GAGAGGTTTCACCAATGGCAA pLKO.1 1176 CDS 100% 2.640 1.320 Y SEC16B n/a
10 TRCN0000201223 GCTGTTTGTCAGATTTGCTTA pLKO.1 5161 3UTR 100% 4.950 2.475 Y Sec16b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001356505.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12924 pDONR223 100% 57.5% 56.4% None (many diffs) n/a
2 ccsbBroad304_12924 pLX_304 0% 57.5% 56.4% V5 (many diffs) n/a
3 TRCN0000468441 GATATATGGATTCGATGTGAGCGT pLX_317 23.9% 57.5% 56.4% V5 (many diffs) n/a
Download CSV