Transcript: Human NM_001362761.2

Homo sapiens transformer 2 alpha homolog (TRA2A), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
TRA2A (29896)
Length:
2377
CDS:
1053..1598

Additional Resources:

NCBI RefSeq record:
NM_001362761.2
NBCI Gene record:
TRA2A (29896)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001362761.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294035 GATAACGGAATGGTTGCAATT pLKO_005 1597 CDS 100% 10.800 15.120 N TRA2A n/a
2 TRCN0000109139 CCATTCTCGATCAAGATCAAA pLKO.1 893 5UTR 100% 5.625 7.875 N Tra2a n/a
3 TRCN0000351905 CCATTCTCGATCAAGATCAAA pLKO_005 893 5UTR 100% 5.625 7.875 N Tra2a n/a
4 TRCN0000074549 CGTCGAGATTCTTACTATGAT pLKO.1 1446 CDS 100% 5.625 7.875 N TRA2A n/a
5 TRCN0000286623 CGTCGAGATTCTTACTATGAT pLKO_005 1446 CDS 100% 5.625 7.875 N TRA2A n/a
6 TRCN0000074551 CGATCTCGAAGTAGATCATAT pLKO.1 990 5UTR 100% 1.320 1.848 N TRA2A n/a
7 TRCN0000074550 GATCTCGAAGTAGATCATATA pLKO.1 991 5UTR 100% 1.320 1.848 N TRA2A n/a
8 TRCN0000293989 TAGATAAACTTCTAGCTAATC pLKO_005 1881 3UTR 100% 10.800 8.640 N TRA2A n/a
9 TRCN0000074552 CGAGATTCTTACTATGATAGA pLKO.1 1449 CDS 100% 4.950 3.960 N TRA2A n/a
10 TRCN0000294037 ATTCGGGTGGATTATTCTATA pLKO_005 1317 CDS 100% 13.200 9.240 N TRA2A n/a
11 TRCN0000294036 CTCCTTATTATAGTCGATATA pLKO_005 1534 CDS 100% 13.200 9.240 N TRA2A n/a
12 TRCN0000074548 CCCAATGTTATGTTATGCTTT pLKO.1 1835 3UTR 100% 4.950 3.465 N TRA2A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001362761.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03099 pDONR223 100% 64.1% 64.1% None 0_1ins303 n/a
2 ccsbBroad304_03099 pLX_304 0% 64.1% 64.1% V5 0_1ins303 n/a
3 TRCN0000472178 TGTCGACCGAAGAGTGCGGCATTG pLX_317 7.6% 64.1% 64.1% V5 0_1ins303 n/a
Download CSV