Transcript: Human NM_001362781.2

Homo sapiens zinc finger and SCAN domain containing 21 (ZSCAN21), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-02
Taxon:
Homo sapiens (human)
Gene:
ZSCAN21 (7589)
Length:
1906
CDS:
165..1517

Additional Resources:

NCBI RefSeq record:
NM_001362781.2
NBCI Gene record:
ZSCAN21 (7589)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001362781.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000015018 GCGTAGTTAAACAGACGTGTA pLKO.1 1752 3UTR 100% 4.050 5.670 N ZSCAN21 n/a
2 TRCN0000274184 CTTAGAGAGGCAGTGCGTAAA pLKO_005 872 CDS 100% 10.800 8.640 N ZSCAN21 n/a
3 TRCN0000274235 TCTGTGATTATCGCCAATAAA pLKO_005 840 CDS 100% 15.000 10.500 N ZSCAN21 n/a
4 TRCN0000015020 CCACAGCTCCAACTTCAATAA pLKO.1 1339 CDS 100% 13.200 9.240 N ZSCAN21 n/a
5 TRCN0000274236 CCACAGCTCCAACTTCAATAA pLKO_005 1339 CDS 100% 13.200 9.240 N ZSCAN21 n/a
6 TRCN0000015019 CCAGTCACAAATACGAGTCTT pLKO.1 667 CDS 100% 4.950 3.465 N ZSCAN21 n/a
7 TRCN0000015021 CCTCAGGAACTGCAAAGGAAT pLKO.1 613 CDS 100% 4.950 3.465 N ZSCAN21 n/a
8 TRCN0000015022 GATCCAAGAAAGGTCCGAGAT pLKO.1 738 CDS 100% 4.050 2.835 N ZSCAN21 n/a
9 TRCN0000274185 GATCCAAGAAAGGTCCGAGAT pLKO_005 738 CDS 100% 4.050 2.835 N ZSCAN21 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001362781.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01800 pDONR223 100% 90.5% 55.2% None 782_783ins103;1317_1350del n/a
2 ccsbBroad304_01800 pLX_304 0% 90.5% 55.2% V5 782_783ins103;1317_1350del n/a
3 TRCN0000478659 CAACTTGGCCTGCCTCGGGAAATT pLX_317 27.1% 90.5% 55.2% V5 782_783ins103;1317_1350del n/a
Download CSV