Transcript: Human NM_001362782.2

Homo sapiens arylsulfatase A (ARSA), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
ARSA (410)
Length:
3859
CDS:
197..1468

Additional Resources:

NCBI RefSeq record:
NM_001362782.2
NBCI Gene record:
ARSA (410)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001362782.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000371344 CATCAGGGCTTCCATCGATTT pLKO_005 356 CDS 100% 10.800 15.120 N ARSA n/a
2 TRCN0000371343 AGAGCTTTGCAGAGCGTTCAG pLKO_005 651 CDS 100% 4.050 5.670 N ARSA n/a
3 TRCN0000371342 GACCTGAGACCATGCGTATGT pLKO_005 792 CDS 100% 4.950 3.465 N ARSA n/a
4 TRCN0000050155 TCTCTTCTTCTACCCGTCCTA pLKO.1 1060 CDS 100% 2.640 1.848 N ARSA n/a
5 TRCN0000050156 CCACACCCACTACCCTCAGTT pLKO.1 622 CDS 100% 1.650 1.155 N ARSA n/a
6 TRCN0000050157 CGGTCTCTTGCGGTGTGGAAA pLKO.1 829 CDS 100% 1.650 1.155 N ARSA n/a
7 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2263 3UTR 100% 13.200 6.600 Y LIAS n/a
8 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 2262 3UTR 100% 4.950 2.475 Y ERAP2 n/a
9 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2954 3UTR 100% 5.625 2.813 Y KLHL30 n/a
10 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2954 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001362782.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10421 pDONR223 100% 83.3% 83.2% None 0_1ins252;920C>G n/a
2 ccsbBroad304_10421 pLX_304 0% 83.3% 83.2% V5 0_1ins252;920C>G n/a
3 TRCN0000472473 TTCTCAGGGTCTATCAGGGAACCA pLX_317 24% 83.3% 83.2% V5 0_1ins252;920C>G n/a
Download CSV