Transcript: Human NM_001362952.1

Homo sapiens nuclear receptor coactivator 1 (NCOA1), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
NCOA1 (8648)
Length:
7401
CDS:
708..4907

Additional Resources:

NCBI RefSeq record:
NM_001362952.1
NBCI Gene record:
NCOA1 (8648)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001362952.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000315044 ACCGACAGAGGCAGCTAATAC pLKO_005 4069 CDS 100% 13.200 18.480 N NCOA1 n/a
2 TRCN0000315045 AGTTACGGCATGCTGATATAG pLKO_005 2638 CDS 100% 13.200 18.480 N NCOA1 n/a
3 TRCN0000004080 CAACCTTTATTCCCAGCCTTA pLKO.1 3671 CDS 100% 4.050 3.240 N NCOA1 n/a
4 TRCN0000095569 CAGCAGCTACTGACTGAATAA pLKO.1 5070 3UTR 100% 13.200 9.240 N Ncoa1 n/a
5 TRCN0000433008 TATGAATGAAGGACCCAATAA pLKO_005 2336 CDS 100% 13.200 9.240 N Ncoa1 n/a
6 TRCN0000004081 GCAGGTGGAAATACGAATGTT pLKO.1 4671 CDS 100% 5.625 3.938 N NCOA1 n/a
7 TRCN0000004078 GCTGAGTCCAAAGATAACAAA pLKO.1 2445 CDS 100% 5.625 3.938 N NCOA1 n/a
8 TRCN0000315113 GCTGAGTCCAAAGATAACAAA pLKO_005 2445 CDS 100% 5.625 3.938 N NCOA1 n/a
9 TRCN0000004082 CTTCAGGTCGTAGCATTTGGA pLKO.1 5193 3UTR 100% 3.000 2.100 N NCOA1 n/a
10 TRCN0000315043 CTTCAGGTCGTAGCATTTGGA pLKO_005 5193 3UTR 100% 3.000 2.100 N NCOA1 n/a
11 TRCN0000004079 CGGAAGTCAGATTGTAGCCAA pLKO.1 2042 CDS 100% 2.640 1.848 N NCOA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001362952.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000473147 TCTATCCCCGTTAGTGATATAACT pLX_317 11.7% 96.3% 96% V5 (many diffs) n/a
Download CSV