Transcript: Human NM_001363014.1

Homo sapiens antizyme inhibitor 1 (AZIN1), transcript variant 10, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
AZIN1 (51582)
Length:
4536
CDS:
1426..2271

Additional Resources:

NCBI RefSeq record:
NM_001363014.1
NBCI Gene record:
AZIN1 (51582)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001363014.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078504 CGGATTTGCTTGTTCCAGTAA pLKO.1 1028 5UTR 100% 4.950 6.930 N AZIN1 n/a
2 TRCN0000286516 CGGATTTGCTTGTTCCAGTAA pLKO_005 1028 5UTR 100% 4.950 6.930 N AZIN1 n/a
3 TRCN0000078503 CGCAGTTAATATCATAGCAAA pLKO.1 1773 CDS 100% 4.950 3.960 N AZIN1 n/a
4 TRCN0000306022 ATGTCTTTCACCCAGATATAT pLKO_005 2649 3UTR 100% 15.000 10.500 N Azin1 n/a
5 TRCN0000298610 TGTGATGAGCTTGATCAAATT pLKO_005 1996 CDS 100% 13.200 9.240 N AZIN1 n/a
6 TRCN0000375151 TGTGATGAGCTTGATCAAATT pLKO_005 1996 CDS 100% 13.200 9.240 N Azin1 n/a
7 TRCN0000115400 CCTGTTGGATGAAGGAACAAA pLKO.1 812 5UTR 100% 5.625 3.938 N Azin1 n/a
8 TRCN0000325635 CCTGTTGGATGAAGGAACAAA pLKO_005 812 5UTR 100% 5.625 3.938 N Azin1 n/a
9 TRCN0000078507 GCAGAATGTAGTGGCTCAGAT pLKO.1 938 5UTR 100% 4.950 3.465 N AZIN1 n/a
10 TRCN0000286517 GCAGAATGTAGTGGCTCAGAT pLKO_005 938 5UTR 100% 4.950 3.465 N AZIN1 n/a
11 TRCN0000078506 GCTTGCAAAGAATCTCAAGTA pLKO.1 1525 CDS 100% 4.950 3.465 N AZIN1 n/a
12 TRCN0000293886 TGGAGATGGAAGCCCATTAAT pLKO_005 2549 3UTR 100% 15.000 9.000 N AZIN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001363014.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03338 pDONR223 100% 62.7% 62.7% None 0_1ins501 n/a
2 ccsbBroad304_03338 pLX_304 0% 62.7% 62.7% V5 0_1ins501 n/a
3 TRCN0000474491 ATCATTTAGAACTAGGCTTATAAT pLX_317 28.5% 62.7% 62.7% V5 0_1ins501 n/a
Download CSV