Transcript: Human NM_001363050.1

Homo sapiens junctophilin 1 (JPH1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
JPH1 (56704)
Length:
4001
CDS:
75..2060

Additional Resources:

NCBI RefSeq record:
NM_001363050.1
NBCI Gene record:
JPH1 (56704)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001363050.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000131051 CAACGATTCATGCCCTGCTTT pLKO.1 1940 CDS 100% 4.950 6.930 N JPH1 n/a
2 TRCN0000129492 GCGAGACTCAACCAAGACAAA pLKO.1 1548 CDS 100% 4.950 3.960 N JPH1 n/a
3 TRCN0000433757 AGCCAATTCAGGCCCTAATTC pLKO_005 1970 CDS 100% 13.200 9.240 N JPH1 n/a
4 TRCN0000433638 ATATTCTGGTCCGTGGGATAA pLKO_005 1075 CDS 100% 10.800 7.560 N JPH1 n/a
5 TRCN0000128220 CCCATGAAAGTTAAGCAAGAT pLKO.1 2719 3UTR 100% 4.950 3.465 N JPH1 n/a
6 TRCN0000129067 GCAAATTCAAGGACTGCACAT pLKO.1 1203 CDS 100% 4.050 2.835 N JPH1 n/a
7 TRCN0000128330 GAACCAAAGTGGAAATAGCAA pLKO.1 1186 CDS 100% 3.000 2.100 N JPH1 n/a
8 TRCN0000129398 GCATTCTCAGTATCACGGCTA pLKO.1 1712 CDS 100% 2.160 1.512 N JPH1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001363050.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08649 pDONR223 100% 99.8% 100% None 9C>A;1242T>C n/a
2 ccsbBroad304_08649 pLX_304 0% 99.8% 100% V5 9C>A;1242T>C n/a
3 TRCN0000480162 CCTGGACACAATCTCTGCAAATTA pLX_317 18% 99.8% 100% V5 9C>A;1242T>C n/a
Download CSV