Transcript: Human NM_001363138.1

Homo sapiens metadherin (MTDH), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
MTDH (92140)
Length:
7563
CDS:
324..1973

Additional Resources:

NCBI RefSeq record:
NM_001363138.1
NBCI Gene record:
MTDH (92140)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001363138.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000155813 CGTGATAAGGTGCTGACTGAT pLKO.1 942 CDS 100% 4.950 6.930 N MTDH n/a
2 TRCN0000322872 CGTGATAAGGTGCTGACTGAT pLKO_005 942 CDS 100% 4.950 6.930 N MTDH n/a
3 TRCN0000152993 GATTCAACTATCCCTGGGATA pLKO.1 975 CDS 100% 4.050 5.670 N MTDH n/a
4 TRCN0000153105 GCAACTTACAACCGCATCATT pLKO.1 1022 CDS 100% 5.625 3.938 N MTDH n/a
5 TRCN0000152120 CCAAGTCAAATACCAAGCAAA pLKO.1 1861 CDS 100% 4.950 3.465 N MTDH n/a
6 TRCN0000322874 CCAAGTCAAATACCAAGCAAA pLKO_005 1861 CDS 100% 4.950 3.465 N MTDH n/a
7 TRCN0000152352 CCAATACTACAAGAGACAGAT pLKO.1 1836 CDS 100% 4.950 3.465 N MTDH n/a
8 TRCN0000322947 CCAATACTACAAGAGACAGAT pLKO_005 1836 CDS 100% 4.950 3.465 N MTDH n/a
9 TRCN0000151467 CGAGGAATAAAGGATTCTGAT pLKO.1 2296 3UTR 100% 4.950 3.465 N MTDH n/a
10 TRCN0000322949 CGAGGAATAAAGGATTCTGAT pLKO_005 2296 3UTR 100% 4.950 3.465 N MTDH n/a
11 TRCN0000151559 GCCTTATTAATGGACAGCTTT pLKO.1 3460 3UTR 100% 4.950 3.465 N MTDH n/a
12 TRCN0000156091 CCGCCAATACTACAAGAGACA pLKO.1 1833 CDS 100% 2.640 1.848 N MTDH n/a
13 TRCN0000138391 CGCCTGTAATCCTAGCACTTT pLKO.1 4540 3UTR 100% 4.950 2.475 Y DENND6A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001363138.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09330 pDONR223 100% 94.2% 93.8% None 232G>T;949A>G;1048_1049ins99 n/a
2 ccsbBroad304_09330 pLX_304 0% 94.2% 93.8% V5 232G>T;949A>G;1048_1049ins99 n/a
3 TRCN0000478940 ATGAGACCATCGGCACTAGAAAAC pLX_317 23.6% 94.2% 93.8% V5 232G>T;949A>G;1048_1049ins99 n/a
Download CSV