Transcript: Human NM_001363152.1

Homo sapiens TBC1 domain family member 31 (TBC1D31), transcript variant 8, mRNA.

Source:
NCBI, updated 2018-07-02
Taxon:
Homo sapiens (human)
Gene:
TBC1D31 (93594)
Length:
3269
CDS:
263..3055

Additional Resources:

NCBI RefSeq record:
NM_001363152.1
NBCI Gene record:
TBC1D31 (93594)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001363152.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000276275 GGTCGAGAGAGAGACCTATTT pLKO_005 3076 3UTR 100% 13.200 18.480 N TBC1D31 n/a
2 TRCN0000143325 GCGTTTAGTACCCTCATAGAT pLKO.1 1283 CDS 100% 5.625 7.875 N TBC1D31 n/a
3 TRCN0000121970 CCATCGGAATAACCTGGATAT pLKO.1 1843 CDS 100% 10.800 8.640 N TBC1D31 n/a
4 TRCN0000276274 ACGGTACATTGCATCTATTAT pLKO_005 901 CDS 100% 15.000 10.500 N TBC1D31 n/a
5 TRCN0000143942 CGGGACAGAATCTTATTAAGA pLKO.1 2958 CDS 100% 5.625 3.938 N TBC1D31 n/a
6 TRCN0000145453 GCAGACTTGTAAACTTCTCTT pLKO.1 826 CDS 100% 4.950 3.465 N TBC1D31 n/a
7 TRCN0000276230 GCAGACTTGTAAACTTCTCTT pLKO_005 826 CDS 100% 4.950 3.465 N TBC1D31 n/a
8 TRCN0000145573 GCTATGGTGAATATCCAACAA pLKO.1 1209 CDS 100% 4.950 3.465 N TBC1D31 n/a
9 TRCN0000142816 CAAGAGATAAATGCGGCTGTA pLKO.1 2780 CDS 100% 4.050 2.835 N TBC1D31 n/a
10 TRCN0000142586 GCAAGAGATAAATGCGGCTGT pLKO.1 2779 CDS 100% 2.160 1.512 N TBC1D31 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001363152.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14346 pDONR223 100% 32.1% 32.1% None (many diffs) n/a
2 ccsbBroad304_14346 pLX_304 0% 32.1% 32.1% V5 (many diffs) n/a
3 TRCN0000492288 TTAACGGCAGGAAGTGCCAACGTA pLX_317 46.9% 32.1% 32.1% V5 (many diffs) n/a
Download CSV