Transcript: Human NM_001363334.1

Homo sapiens zinc finger protein 655 (ZNF655), transcript variant 13, mRNA.

Source:
NCBI, updated 2018-06-15
Taxon:
Homo sapiens (human)
Gene:
ZNF655 (79027)
Length:
4580
CDS:
216..1691

Additional Resources:

NCBI RefSeq record:
NM_001363334.1
NBCI Gene record:
ZNF655 (79027)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001363334.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3679 3UTR 100% 4.950 2.475 Y KAAG1 n/a
2 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 3383 3UTR 100% 4.950 2.475 Y CFLAR n/a
3 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 3383 3UTR 100% 4.950 2.475 Y C19orf31 n/a
4 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 3381 3UTR 100% 4.950 2.475 Y ERN2 n/a
5 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 3381 3UTR 100% 4.950 2.475 Y P3H4 n/a
6 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 3381 3UTR 100% 4.950 2.475 Y P3H4 n/a
7 TRCN0000162548 CACACACACACACACAAATAT pLKO.1 3683 3UTR 100% 15.000 7.500 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001363334.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08908 pDONR223 100% 99.9% 99.7% None 156G>T n/a
2 ccsbBroad304_08908 pLX_304 0% 99.9% 99.7% V5 156G>T n/a
3 TRCN0000467232 CCATCTTTAAACGACTAACACCTT pLX_317 29.8% 99.9% 99.7% V5 156G>T n/a
Download CSV