Transcript: Human NM_001363466.2

Homo sapiens family with sequence similarity 126 member A (FAM126A), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
FAM126A (84668)
Length:
13474
CDS:
235..1494

Additional Resources:

NCBI RefSeq record:
NM_001363466.2
NBCI Gene record:
FAM126A (84668)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001363466.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000148197 GACCTCCTAGTATTAGCATTA pLKO.1 2059 3UTR 100% 10.800 15.120 N FAM126A n/a
2 TRCN0000129209 CCACAAAGTGAGTTGCTAGAA pLKO.1 376 CDS 100% 4.950 6.930 N FAM126A n/a
3 TRCN0000149233 GCAAAGATCACTTTGCTCGAA pLKO.1 1732 3UTR 100% 0.264 0.370 N FAM126A n/a
4 TRCN0000149147 GCCCAGCTAGAATTATATCCA pLKO.1 1033 CDS 100% 3.000 2.400 N FAM126A n/a
5 TRCN0000150248 GCTTCAATTTACGCTGCAATT pLKO.1 447 CDS 100% 10.800 7.560 N FAM126A n/a
6 TRCN0000128334 GTTACAATGCTGCCTTAACTT pLKO.1 794 CDS 100% 5.625 3.938 N FAM126A n/a
7 TRCN0000128308 GAACTTCCAATGAAGCATCAA pLKO.1 2025 3UTR 100% 4.950 3.465 N FAM126A n/a
8 TRCN0000128227 CAGGAGAATCACTTGAATCTA pLKO.1 7321 3UTR 100% 5.625 2.813 Y NLRP8 n/a
9 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 11926 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001363466.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04411 pDONR223 100% 72.3% 66.6% None (many diffs) n/a
2 ccsbBroad304_04411 pLX_304 0% 72.3% 66.6% V5 (many diffs) n/a
3 TRCN0000479538 CCGTAGCTAACTGCAGGACGGTTG pLX_317 17.5% 72.3% 66.6% V5 (many diffs) n/a
Download CSV