Transcript: Human NM_001363522.1

Homo sapiens glutamate metabotropic receptor 3 (GRM3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
GRM3 (2913)
Length:
3198
CDS:
1105..2718

Additional Resources:

NCBI RefSeq record:
NM_001363522.1
NBCI Gene record:
GRM3 (2913)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001363522.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000357377 TGATAAGTCGCGCTATGATTA pLKO_005 1641 CDS 100% 13.200 18.480 N GRM3 n/a
2 TRCN0000357376 AGTGGATGAAGCTGAGTATAT pLKO_005 1461 CDS 100% 13.200 9.240 N GRM3 n/a
3 TRCN0000009015 CAGAACATGGAAATAACCATT pLKO.1 2884 3UTR 100% 4.950 3.465 N GRM3 n/a
4 TRCN0000009017 GCCTGTTTCCTATTAACGAAA pLKO.1 1232 CDS 100% 4.950 3.465 N GRM3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001363522.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489865 CCGGAGACCTTGTCAATGTGGGAC pLX_317 15.3% 58.6% 52.7% V5 1324_1325ins1067;1571_1611delinsG n/a
2 TRCN0000487741 GGCAGTTTCAGTCTATCACAGTTA pLX_317 11.2% 58.6% 52.8% V5 (not translated due to prior stop codon) 1324_1325ins1067;1571_1611del n/a
Download CSV