Transcript: Human NM_001363695.2

Homo sapiens palmitoyl-protein thioesterase 1 (PPT1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
PPT1 (5538)
Length:
3463
CDS:
15..863

Additional Resources:

NCBI RefSeq record:
NM_001363695.2
NBCI Gene record:
PPT1 (5538)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001363695.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000298496 CAGATCCAGCTTGCAACTAAT pLKO_005 953 3UTR 100% 13.200 18.480 N PPT1 n/a
2 TRCN0000298493 TACCTGGAATTTACGTCTTAT pLKO_005 199 CDS 100% 0.000 0.000 N PPT1 n/a
3 TRCN0000029216 GCACTTGCTAAGGATCCTAAA pLKO.1 306 CDS 100% 10.800 7.560 N PPT1 n/a
4 TRCN0000293380 GCACTTGCTAAGGATCCTAAA pLKO_005 306 CDS 100% 10.800 7.560 N PPT1 n/a
5 TRCN0000029214 CCCATAAAGGAGGATGTGTAT pLKO.1 579 CDS 100% 4.950 3.465 N PPT1 n/a
6 TRCN0000029218 CGTGGAGAACAGCTTCTTCTT pLKO.1 251 CDS 100% 4.950 3.465 N PPT1 n/a
7 TRCN0000298490 CGTGGAGAACAGCTTCTTCTT pLKO_005 251 CDS 100% 4.950 3.465 N PPT1 n/a
8 TRCN0000029217 GCCCACATCATACCATTCCTT pLKO.1 837 CDS 100% 3.000 2.100 N PPT1 n/a
9 TRCN0000293381 GCCCACATCATACCATTCCTT pLKO_005 837 CDS 100% 3.000 2.100 N PPT1 n/a
10 TRCN0000200867 GTTTGTGATGGTGAAATTCTT pLKO.1 686 CDS 100% 5.625 3.938 N Ppt1 n/a
11 TRCN0000292658 GTTTGTGATGGTGAAATTCTT pLKO_005 686 CDS 100% 5.625 3.938 N Ppt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001363695.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01271 pDONR223 100% 92.1% 92.1% None 724_725ins72 n/a
2 ccsbBroad304_01271 pLX_304 0% 92.1% 92.1% V5 724_725ins72 n/a
Download CSV