Transcript: Human NM_001363732.1

Homo sapiens leucine rich repeat containing 49 (LRRC49), transcript variant 5, mRNA.

Source:
NCBI, updated 2018-06-15
Taxon:
Homo sapiens (human)
Gene:
LRRC49 (54839)
Length:
2993
CDS:
1330..2508

Additional Resources:

NCBI RefSeq record:
NM_001363732.1
NBCI Gene record:
LRRC49 (54839)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001363732.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243994 TAGCCCAAAGCACGTAGTATT pLKO_005 2804 3UTR 100% 13.200 18.480 N LRRC49 n/a
2 TRCN0000243991 TGCGGGCTTCATCTGGTTATT pLKO_005 507 5UTR 100% 13.200 18.480 N LRRC49 n/a
3 TRCN0000172779 GCTGACCGTATGTCCTATCAT pLKO.1 750 5UTR 100% 5.625 7.875 N LRRC49 n/a
4 TRCN0000243995 AGTCATAGAAATTCGCAATAA pLKO_005 2439 CDS 100% 13.200 10.560 N LRRC49 n/a
5 TRCN0000243993 GAAGTTAATATCGTTGGATTT pLKO_005 849 5UTR 100% 10.800 7.560 N LRRC49 n/a
6 TRCN0000168388 GCTCAAGAGTCATGGTACAAA pLKO.1 1291 5UTR 100% 5.625 3.938 N LRRC49 n/a
7 TRCN0000176668 CATGGAAATCAGATTACCAAA pLKO.1 1003 5UTR 100% 4.950 3.465 N Lrrc49 n/a
8 TRCN0000168389 GAGTGTTCAAACAGCAGGAAT pLKO.1 1746 CDS 100% 4.950 3.465 N LRRC49 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001363732.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12095 pDONR223 100% 56.9% 56.9% None 0_1ins882;172_174delCAA n/a
2 ccsbBroad304_12095 pLX_304 0% 56.9% 56.9% V5 0_1ins882;172_174delCAA n/a
3 TRCN0000479320 ACTCCCAGGACAATCGTCTAACCC pLX_317 19.3% 56.9% 56.9% V5 0_1ins882;172_174delCAA n/a
Download CSV