Transcript: Human NM_001363735.1

Homo sapiens transmembrane p24 trafficking protein 3 (TMED3), transcript variant 5, mRNA.

Source:
NCBI, updated 2018-06-15
Taxon:
Homo sapiens (human)
Gene:
TMED3 (23423)
Length:
1342
CDS:
189..629

Additional Resources:

NCBI RefSeq record:
NM_001363735.1
NBCI Gene record:
TMED3 (23423)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001363735.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000065031 CACTACGATGTTGACTGCTAT pLKO.1 372 CDS 100% 4.950 6.930 N TMED3 n/a
2 TRCN0000065029 GCTGAAGTCAAGGGCGTTTAT pLKO.1 462 CDS 100% 13.200 9.240 N TMED3 n/a
3 TRCN0000298996 GCTGAAGTCAAGGGCGTTTAT pLKO_005 462 CDS 100% 13.200 9.240 N TMED3 n/a
4 TRCN0000065030 CTCTCACAAGACCGTCTACTT pLKO.1 515 CDS 100% 4.950 3.465 N TMED3 n/a
5 TRCN0000298995 CTCTCACAAGACCGTCTACTT pLKO_005 515 CDS 100% 4.950 3.465 N TMED3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001363735.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02764 pDONR223 100% 64.8% 64.2% None (many diffs) n/a
2 ccsbBroad304_02764 pLX_304 0% 64.8% 64.2% V5 (many diffs) n/a
3 TRCN0000471079 GATCCCCTTTATACCTCCTTTTGA pLX_317 83.9% 64.8% 64.2% V5 (many diffs) n/a
Download CSV