Transcript: Human NM_001363748.2

Homo sapiens EPH receptor A4 (EPHA4), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
EPHA4 (2043)
Length:
6391
CDS:
57..2906

Additional Resources:

NCBI RefSeq record:
NM_001363748.2
NBCI Gene record:
EPHA4 (2043)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001363748.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220020 AGCAATTGCCTATCGTAAATT pLKO.1 2438 CDS 100% 15.000 21.000 N EPHA4 n/a
2 TRCN0000195102 CACTGAAGAGTGCGTTTATTT pLKO.1 6028 3UTR 100% 15.000 21.000 N EPHA4 n/a
3 TRCN0000220022 GTTGAATGCGAACGAATATAT pLKO.1 4925 3UTR 100% 15.000 21.000 N EPHA4 n/a
4 TRCN0000380628 ATGAGCGAAGCTATCGTATAG pLKO_005 1507 CDS 100% 10.800 15.120 N EPHA4 n/a
5 TRCN0000344513 ATCAGCCGGAGACGGAGTAAA pLKO_005 1761 CDS 100% 13.200 10.560 N EPHA4 n/a
6 TRCN0000220021 GATTGGCTCCAGGCCATTAAA pLKO.1 2808 CDS 100% 15.000 10.500 N EPHA4 n/a
7 TRCN0000332976 GATTGGCTCCAGGCCATTAAA pLKO_005 2808 CDS 100% 15.000 10.500 N EPHA4 n/a
8 TRCN0000010164 GGGTCTGGGATGAAGTATTTA pLKO.1 2247 CDS 100% 15.000 10.500 N EPHA4 n/a
9 TRCN0000010165 TCAGTCCGTGTGTTCTATAAA pLKO.1 642 CDS 100% 15.000 10.500 N EPHA4 n/a
10 TRCN0000344512 TCAGTCCGTGTGTTCTATAAA pLKO_005 642 CDS 100% 15.000 10.500 N EPHA4 n/a
11 TRCN0000196950 GACTTGCAAGGAGACGTTTAA pLKO.1 404 CDS 100% 13.200 9.240 N EPHA4 n/a
12 TRCN0000344511 GACTTGCAAGGAGACGTTTAA pLKO_005 404 CDS 100% 13.200 9.240 N EPHA4 n/a
13 TRCN0000382495 GCAATTGCCTATCGTAAATTC pLKO_005 2439 CDS 100% 13.200 9.240 N EPHA4 n/a
14 TRCN0000010161 GCCAGGAACACAGATATCAAA pLKO.1 1539 CDS 100% 5.625 3.938 N EPHA4 n/a
15 TRCN0000010153 CCAAGCAGCACCATCATCCAT pLKO.1 1367 CDS 100% 3.000 2.100 N EPHA4 n/a
16 TRCN0000194901 CCAATCAAGATGTGATTAAAG pLKO.1 2542 CDS 100% 1.320 0.660 Y EPHA4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001363748.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14627 pDONR223 0% 96.2% 96.2% None 2847_2848ins111 n/a
2 ccsbBroad304_14627 pLX_304 0% 96.2% 96.2% V5 2847_2848ins111 n/a
3 TRCN0000480032 GCTATGCCGAACCCCACGACAGTT pLX_317 10.9% 96.2% 96.2% V5 2847_2848ins111 n/a
4 TRCN0000488992 TTACAATGCTTAACTTCGTTATCT pLX_317 27.3% 37% V5 (not translated due to prior stop codon) 1_1750del;2847_2848ins111 n/a
Download CSV