Transcript: Mouse NM_001363757.1

Mus musculus wingless-type MMTV integration site family, member 7A (Wnt7a), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-11
Taxon:
Mus musculus (mouse)
Gene:
Wnt7a (22421)
Length:
3007
CDS:
245..691

Additional Resources:

NCBI RefSeq record:
NM_001363757.1
NBCI Gene record:
Wnt7a (22421)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001363757.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000071789 TGCGAGCATCATCTGTAACAA pLKO.1 343 CDS 100% 5.625 7.875 N Wnt7a n/a
2 TRCN0000071790 CGGAGATGTATACGTGCAAGT pLKO.1 1117 3UTR 100% 4.050 5.670 N Wnt7a n/a
3 TRCN0000071788 TGTCAGTTTCAGTTCCGAAAT pLKO.1 461 CDS 100% 10.800 8.640 N Wnt7a n/a
4 TRCN0000441773 TCTTCGGGAAGGAGCTCAAAG pLKO_005 519 CDS 100% 10.800 7.560 N WNT7A n/a
5 TRCN0000071792 GCTCAAGGACAAATACAACGA pLKO.1 770 3UTR 100% 2.640 1.848 N Wnt7a n/a
6 TRCN0000429092 GTGGCAGTGCAACTGCAAATT pLKO_005 1052 3UTR 100% 13.200 7.920 N WNT7B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001363757.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01780 pDONR223 100% 39.7% 38.9% None (many diffs) n/a
2 ccsbBroad304_01780 pLX_304 0% 39.7% 38.9% V5 (many diffs) n/a
3 TRCN0000471010 GACCGGAGCCCCTCAGTGTGATTG pLX_317 28.8% 39.7% 38.9% V5 (many diffs) n/a
Download CSV