Transcript: Human NM_001363889.2

Homo sapiens DNA topoisomerase II binding protein 1 (TOPBP1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
TOPBP1 (11073)
Length:
5746
CDS:
181..4734

Additional Resources:

NCBI RefSeq record:
NM_001363889.2
NBCI Gene record:
TOPBP1 (11073)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001363889.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000049406 GCGTAAGTGAATCAATATGTA pLKO.1 1136 CDS 100% 5.625 7.875 N TOPBP1 n/a
2 TRCN0000333044 GCGTAAGTGAATCAATATGTA pLKO_005 1136 CDS 100% 5.625 7.875 N TOPBP1 n/a
3 TRCN0000369629 GATAGATTTGGGTAGTAATTT pLKO_005 4801 3UTR 100% 15.000 10.500 N TOPBP1 n/a
4 TRCN0000049405 GCTGCAAAGAAGTGGAATTTA pLKO.1 2284 CDS 100% 15.000 10.500 N TOPBP1 n/a
5 TRCN0000333045 GCTGCAAAGAAGTGGAATTTA pLKO_005 2284 CDS 100% 15.000 10.500 N TOPBP1 n/a
6 TRCN0000049407 GCCTAGTTGTCCCACACAATA pLKO.1 3654 CDS 100% 13.200 9.240 N TOPBP1 n/a
7 TRCN0000049403 CCGTCGTTACACCTTTAGATA pLKO.1 2492 CDS 100% 5.625 3.938 N TOPBP1 n/a
8 TRCN0000333112 CCGTCGTTACACCTTTAGATA pLKO_005 2492 CDS 100% 5.625 3.938 N TOPBP1 n/a
9 TRCN0000049404 CCCTTTAATGATTCTACTCAT pLKO.1 1696 CDS 100% 4.950 3.465 N TOPBP1 n/a
10 TRCN0000363670 CCCTTTAATGATTCTACTCAT pLKO_005 1696 CDS 100% 4.950 3.465 N TOPBP1 n/a
11 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 5466 3UTR 100% 13.200 6.600 Y LIAS n/a
12 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 5633 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001363889.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11589 pDONR223 100% 93.9% 93.8% None 1_261del;922_923insGTCGTACTCTTTCAG n/a
2 ccsbBroad304_11589 pLX_304 0% 93.9% 93.8% V5 1_261del;922_923insGTCGTACTCTTTCAG n/a
3 TRCN0000478228 GCTATTCCCCTTTACGTTGGTTAA pLX_317 6.2% 93.9% 93.8% V5 1_261del;922_923insGTCGTACTCTTTCAG n/a
Download CSV