Transcript: Human NM_001363907.1

Homo sapiens interferon regulatory factor 8 (IRF8), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
IRF8 (3394)
Length:
2669
CDS:
32..1342

Additional Resources:

NCBI RefSeq record:
NM_001363907.1
NBCI Gene record:
IRF8 (3394)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001363907.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435466 CAGATAGCTGCTTCGATAAAG pLKO_005 1683 3UTR 100% 13.200 18.480 N IRF8 n/a
2 TRCN0000020988 GCCTCACACCAGAGATCATTT pLKO.1 1292 CDS 100% 13.200 18.480 N IRF8 n/a
3 TRCN0000020984 GCCCGCATCATGATTAAAGAA pLKO.1 1402 3UTR 100% 5.625 7.875 N IRF8 n/a
4 TRCN0000020985 CCATACAAAGTTTACCGAATT pLKO.1 377 CDS 100% 0.000 0.000 N IRF8 n/a
5 TRCN0000429151 ACGCTGGCAAGCAAGATTATA pLKO_005 186 CDS 100% 15.000 10.500 N IRF8 n/a
6 TRCN0000020987 GCATGTATCCAGGACTGATTT pLKO.1 123 CDS 100% 13.200 9.240 N IRF8 n/a
7 TRCN0000020986 GCTTTGAATAAGAGCCCAGAT pLKO.1 314 CDS 100% 4.050 2.835 N IRF8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001363907.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00814 pDONR223 100% 97.7% 97.7% None 1_30del n/a
2 ccsbBroad304_00814 pLX_304 0% 97.7% 97.7% V5 1_30del n/a
3 TRCN0000479153 CAGCTTATAAAAGTATTGATGTTG pLX_317 36.5% 97.7% 97.7% V5 1_30del n/a
Download CSV