Transcript: Human NM_001363963.1

Homo sapiens derlin 1 (DERL1), transcript variant 4, mRNA.

Source:
NCBI, updated 2018-09-30
Taxon:
Homo sapiens (human)
Gene:
DERL1 (79139)
Length:
2824
CDS:
86..541

Additional Resources:

NCBI RefSeq record:
NM_001363963.1
NBCI Gene record:
DERL1 (79139)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001363963.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000062914 GCCAGCAGACTATTTATTCAT pLKO.1 67 5UTR 100% 5.625 7.875 N DERL1 n/a
2 TRCN0000300929 GCCAGCAGACTATTTATTCAT pLKO_005 67 5UTR 100% 5.625 7.875 N DERL1 n/a
3 TRCN0000062915 GCTCGGTAATCAATGAGCTTA pLKO.1 288 CDS 100% 4.950 6.930 N DERL1 n/a
4 TRCN0000062916 CCTAATGTTCAGATACCCAAT pLKO.1 340 CDS 100% 4.050 5.670 N DERL1 n/a
5 TRCN0000300869 CCTAATGTTCAGATACCCAAT pLKO_005 340 CDS 100% 4.050 5.670 N DERL1 n/a
6 TRCN0000062913 CCTGCTATTTACCCTGGGTTA pLKO.1 240 CDS 100% 4.050 5.670 N DERL1 n/a
7 TRCN0000300927 CCTGCTATTTACCCTGGGTTA pLKO_005 240 CDS 100% 4.050 5.670 N DERL1 n/a
8 TRCN0000126852 GTTCAGATACCCAATGGACTT pLKO.1 346 CDS 100% 4.050 3.240 N Derl1 n/a
9 TRCN0000316830 GTTCAGATACCCAATGGACTT pLKO_005 346 CDS 100% 4.050 3.240 N Derl1 n/a
10 TRCN0000062917 CCTTGGATTCAACTATATCAT pLKO.1 262 CDS 100% 5.625 3.938 N DERL1 n/a
11 TRCN0000300930 CCTTGGATTCAACTATATCAT pLKO_005 262 CDS 100% 5.625 3.938 N DERL1 n/a
12 TRCN0000126851 GCAGACTATTTATTCATGCTT pLKO.1 71 5UTR 100% 3.000 4.200 N Derl1 n/a
13 TRCN0000316899 GCAGACTATTTATTCATGCTT pLKO_005 71 5UTR 100% 3.000 4.200 N Derl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001363963.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04053 pDONR223 100% 60.1% 60.1% None 0_1ins300 n/a
2 ccsbBroad304_04053 pLX_304 0% 60.1% 60.1% V5 0_1ins300 n/a
3 TRCN0000474414 ATGTTCAGCCGTCGTTCGTAGTGG pLX_317 66.7% 60.1% 60.1% V5 0_1ins300 n/a
Download CSV