Transcript: Human NM_001364151.1

Homo sapiens drebrin 1 (DBN1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
DBN1 (1627)
Length:
3039
CDS:
114..2198

Additional Resources:

NCBI RefSeq record:
NM_001364151.1
NBCI Gene record:
DBN1 (1627)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001364151.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435393 GTGCCACCCTTCTCAACTTTG pLKO_005 1828 CDS 100% 10.800 15.120 N DBN1 n/a
2 TRCN0000424992 ATCAACTGGGTGGGCGAAGAT pLKO_005 357 CDS 100% 4.950 6.930 N DBN1 n/a
3 TRCN0000421221 TGATGTACCCTCGCCCTTCAA pLKO_005 1034 CDS 100% 4.950 6.930 N DBN1 n/a
4 TRCN0000417876 ACCAGCCTCATTGACCTATGG pLKO_005 1665 CDS 100% 4.050 5.670 N DBN1 n/a
5 TRCN0000419077 AGGAGCTTTCGGGACACTTTG pLKO_005 265 CDS 100% 10.800 7.560 N DBN1 n/a
6 TRCN0000426856 AGTTGAGACGCTGTTGCAAAT pLKO_005 2436 3UTR 100% 10.800 7.560 N DBN1 n/a
7 TRCN0000063958 CTGTGGAAATGAAGCGGATTA pLKO.1 616 CDS 100% 10.800 7.560 N DBN1 n/a
8 TRCN0000416221 GGTCCAGATTGTAGCTCTTAG pLKO_005 2474 3UTR 100% 10.800 7.560 N DBN1 n/a
9 TRCN0000063962 CAATCACAGGAGGAGGAGTTT pLKO.1 2046 CDS 100% 4.950 3.465 N DBN1 n/a
10 TRCN0000423695 CCCTGCAGAGGACTTGATGTT pLKO_005 1496 CDS 100% 4.950 3.465 N DBN1 n/a
11 TRCN0000423044 ACCTCAAGCTTGCAGCATCAG pLKO_005 232 CDS 100% 4.050 2.835 N DBN1 n/a
12 TRCN0000428373 GCAGACTTTAGAAGCGGAAGA pLKO_005 827 CDS 100% 4.050 2.835 N DBN1 n/a
13 TRCN0000063960 CAGTCTATCTTTGGTGACCAT pLKO.1 870 CDS 100% 2.640 1.848 N DBN1 n/a
14 TRCN0000090077 GCAGTCTATCTTTGGTGACCA pLKO.1 869 CDS 100% 2.640 1.848 N Dbn1 n/a
15 TRCN0000335208 GCAGTCTATCTTTGGTGACCA pLKO_005 869 CDS 100% 2.640 1.848 N Dbn1 n/a
16 TRCN0000063959 CCTGTGTTCTACAACAAGCCT pLKO.1 2103 CDS 100% 0.750 0.525 N DBN1 n/a
17 TRCN0000063961 GCTCTGTACACATATGAAGAT pLKO.1 201 CDS 100% 0.000 0.000 N DBN1 n/a
18 TRCN0000414374 TTGTACAGTTGACTGGCTTTC pLKO_005 2404 3UTR 100% 6.000 3.600 N DBN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001364151.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06083 pDONR223 100% 93.1% 93% None (many diffs) n/a
2 ccsbBroad304_06083 pLX_304 0% 93.1% 93% V5 (many diffs) n/a
3 TRCN0000468161 CGATGTTATATATTCCGTACTAAC pLX_317 17.6% 93.1% 93% V5 (many diffs) n/a
Download CSV