Transcript: Human NM_001364171.2

Homo sapiens coiled-coil domain containing 114 (CCDC114), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
CCDC114 (93233)
Length:
2995
CDS:
358..2481

Additional Resources:

NCBI RefSeq record:
NM_001364171.2
NBCI Gene record:
CCDC114 (93233)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001364171.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000131033 CCACTTCCTCAAGCTCAAGAA pLKO.1 1140 CDS 100% 4.950 3.465 N CCDC114 n/a
2 TRCN0000131237 GCGCAACTTTGCTGAGTTCAA pLKO.1 1353 CDS 100% 4.950 3.465 N CCDC114 n/a
3 TRCN0000127935 CAACTTCATCAACGAGCAGAA pLKO.1 1371 CDS 100% 4.050 2.835 N CCDC114 n/a
4 TRCN0000131009 CCTGAATAAACTGTCCCAGCT pLKO.1 1278 CDS 100% 2.160 1.512 N CCDC114 n/a
5 TRCN0000127820 GCTGAGTTCAACTTCATCAAC pLKO.1 1363 CDS 100% 4.950 2.970 N CCDC114 n/a
6 TRCN0000129391 GCAGGAAGAGATCAAGGAGAT pLKO.1 1410 CDS 100% 4.050 2.430 N CCDC114 n/a
7 TRCN0000130950 CCTCAAGCTCAAGAACAACGA pLKO.1 1146 CDS 100% 2.640 1.584 N CCDC114 n/a
8 TRCN0000129373 GCAGAAGTATCTGGAGATCGA pLKO.1 1329 CDS 100% 2.640 1.584 N CCDC114 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001364171.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12993 pDONR223 100% 65.4% 65.4% None 1_732del n/a
2 ccsbBroad304_12993 pLX_304 0% 65.4% 65.4% V5 1_732del n/a
3 TRCN0000478187 CGAACCATCAGACAAATGTTACTA pLX_317 12.8% 65.4% 65.4% V5 1_732del n/a
4 ccsbBroadEn_16070 pDONR223 0% 65.3% 65.4% None 1_732del;918C>T;2019T>C n/a
5 ccsbBroad304_16070 pLX_304 0% 65.3% 65.4% V5 1_732del;918C>T;2019T>C n/a
6 TRCN0000465215 TTCATTACCATAACTCGGTGGCCA pLX_317 12.8% 65.3% 65.4% V5 1_732del;918C>T;2019T>C n/a
Download CSV