Transcript: Human NM_001364500.2

Homo sapiens dipeptidyl peptidase like 6 (DPP6), transcript variant 9, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
DPP6 (1804)
Length:
4698
CDS:
479..2893

Additional Resources:

NCBI RefSeq record:
NM_001364500.2
NBCI Gene record:
DPP6 (1804)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001364500.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046657 CATGTCAAGAAGGCCATAAAT pLKO.1 2036 CDS 100% 15.000 21.000 N DPP6 n/a
2 TRCN0000046654 CCGGACGAAAGCCATTACTTT pLKO.1 2753 CDS 100% 5.625 7.875 N DPP6 n/a
3 TRCN0000046655 CCCATATATCAACACTCGTAT pLKO.1 920 CDS 100% 4.950 6.930 N DPP6 n/a
4 TRCN0000428050 TAGCAGTGCGTGTTCATATAT pLKO_005 3357 3UTR 100% 15.000 10.500 N DPP6 n/a
5 TRCN0000046653 CCCTACACGTTATTGGCTTAA pLKO.1 1359 CDS 100% 10.800 7.560 N DPP6 n/a
6 TRCN0000046656 GCAGAACTCATTACACAACTA pLKO.1 2696 CDS 100% 4.950 3.465 N DPP6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001364500.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06117 pDONR223 100% 98.5% 97.1% None (many diffs) n/a
2 TRCN0000475895 TGACCAGGCTTGGCCAATGACTTC pLX_317 14.3% 98.5% 97.1% V5 (many diffs) n/a
3 ccsbBroadEn_14618 pDONR223 50.6% 98.5% 97.1% None (many diffs) n/a
Download CSV