Transcript: Human NM_001364749.1

Homo sapiens PTOV1 extended AT-hook containing adaptor protein (PTOV1), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-01-23
Taxon:
Homo sapiens (human)
Gene:
PTOV1 (53635)
Length:
1708
CDS:
177..1472

Additional Resources:

NCBI RefSeq record:
NM_001364749.1
NBCI Gene record:
PTOV1 (53635)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001364749.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000139649 CCTACAAAGCATCGTGTGAGA pLKO.1 1282 CDS 100% 2.640 3.696 N PTOV1 n/a
2 TRCN0000140735 GCTCCTGTACTCTTCAGAGAA pLKO.1 1316 CDS 100% 4.950 3.960 N PTOV1 n/a
3 TRCN0000140104 GTTCCACTTCACCAACAGAGA pLKO.1 713 CDS 100% 2.640 2.112 N PTOV1 n/a
4 TRCN0000281091 GTTCCACTTCACCAACAGAGA pLKO_005 713 CDS 100% 2.640 2.112 N PTOV1 n/a
5 TRCN0000122043 CAGATCGTCAACAACAAGTTT pLKO.1 972 CDS 100% 5.625 3.938 N PTOV1 n/a
6 TRCN0000143905 CCTGTACTCTTCAGAGAAGAA pLKO.1 1319 CDS 100% 4.950 3.465 N PTOV1 n/a
7 TRCN0000281092 CCTGTACTCTTCAGAGAAGAA pLKO_005 1319 CDS 100% 4.950 3.465 N PTOV1 n/a
8 TRCN0000140055 CTACTCTGACTCCACTGCAAA pLKO.1 542 CDS 100% 4.950 3.465 N PTOV1 n/a
9 TRCN0000281022 CTACTCTGACTCCACTGCAAA pLKO_005 542 CDS 100% 4.950 3.465 N PTOV1 n/a
10 TRCN0000140135 GAAGCTGTACATGCAGCTCAT pLKO.1 1121 CDS 100% 0.405 0.284 N PTOV1 n/a
11 TRCN0000139117 CAGTTCCACTTCACCAACAGA pLKO.1 711 CDS 100% 3.000 1.800 N PTOV1 n/a
12 TRCN0000143781 GTCAACAACAAGTTTCTGGCA pLKO.1 978 CDS 100% 0.660 0.396 N PTOV1 n/a
13 TRCN0000281090 GTCAACAACAAGTTTCTGGCA pLKO_005 978 CDS 100% 0.660 0.396 N PTOV1 n/a
14 TRCN0000140599 GAAGCTGATCATGCAGCTGAT pLKO.1 635 CDS 100% 0.405 0.243 N PTOV1 n/a
15 TRCN0000139737 CCTGTACTCGTCCAAGAAGAA pLKO.1 836 CDS 100% 4.950 2.475 Y PTOV1 n/a
16 TRCN0000121936 CTCGTCCAAGAAGAAGATCTT pLKO.1 842 CDS 100% 4.950 2.475 Y PTOV1 n/a
17 TRCN0000143741 GTACTCGTCCAAGAAGAAGAT pLKO.1 839 CDS 100% 4.950 2.475 Y PTOV1 n/a
18 TRCN0000281089 GTACTCGTCCAAGAAGAAGAT pLKO_005 839 CDS 100% 4.950 2.475 Y PTOV1 n/a
19 TRCN0000144585 GTCCAAGAAGAAGATCTTCAT pLKO.1 845 CDS 100% 4.950 2.475 Y PTOV1 n/a
20 TRCN0000140076 GAAGATCTTCATGGGCCTCAT pLKO.1 854 CDS 100% 4.050 2.025 Y PTOV1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001364749.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.