Transcript: Human NM_001364858.1

Homo sapiens adaptor related protein complex 5 subunit zeta 1 (AP5Z1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
AP5Z1 (9907)
Length:
5342
CDS:
375..2330

Additional Resources:

NCBI RefSeq record:
NM_001364858.1
NBCI Gene record:
AP5Z1 (9907)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001364858.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000020690 GCGCCTCATTGAGCAAAGTAA pLKO.1 812 CDS 100% 5.625 7.875 N AP5Z1 n/a
2 TRCN0000256547 AGGGACTTCGGTGCAGATTAA pLKO_005 2344 3UTR 100% 13.200 9.240 N AP5Z1 n/a
3 TRCN0000256545 TTCTGTTCCCGGATCTGTAAA pLKO_005 163 5UTR 100% 13.200 9.240 N AP5Z1 n/a
4 TRCN0000256544 GCCTCTTTATTGCTGTCAAAG pLKO_005 2061 CDS 100% 10.800 7.560 N AP5Z1 n/a
5 TRCN0000256546 ATCATCTCAGCCACGAAGTAC pLKO_005 244 5UTR 100% 4.950 3.465 N AP5Z1 n/a
6 TRCN0000020693 CGTGGAGCAGATCAACAAGTT pLKO.1 1895 CDS 100% 4.950 3.465 N AP5Z1 n/a
7 TRCN0000256543 AGCACCCTCAGATTGAGCTTC pLKO_005 1182 CDS 100% 4.050 2.835 N AP5Z1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001364858.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11430 pDONR223 100% 68.4% 68.3% None 1338_1953delinsG n/a
2 ccsbBroad304_11430 pLX_304 0% 68.4% 68.3% V5 1338_1953delinsG n/a
Download CSV