Transcript: Human NM_001365428.1

Homo sapiens TRPM8 channel associated factor 2 (TCAF2), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-03-22
Taxon:
Homo sapiens (human)
Gene:
TCAF2 (285966)
Length:
2315
CDS:
268..1962

Additional Resources:

NCBI RefSeq record:
NM_001365428.1
NBCI Gene record:
TCAF2 (285966)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001365428.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149150 GTCTCACTCACCTTCTGATTT pLKO.1 2124 3UTR 100% 13.200 6.600 Y TCAF2 n/a
2 TRCN0000148500 CGTGGAGATCAATGGAATCAA pLKO.1 1014 CDS 100% 5.625 2.813 Y TCAF2 n/a
3 TRCN0000146482 CTGGCAAAGTTGAGAGTTGAT pLKO.1 733 CDS 100% 4.950 2.475 Y TCAF2 n/a
4 TRCN0000149429 CTGTAACCTTTGGTCAGTCTA pLKO.1 1758 CDS 100% 4.950 2.475 Y TCAF2 n/a
5 TRCN0000127838 GAACAGCGACTTGTGTGTCTA pLKO.1 405 CDS 100% 4.950 2.475 Y TCAF2 n/a
6 TRCN0000148012 GAAGGAGATCATCAATGAGAT pLKO.1 1638 CDS 100% 4.950 2.475 Y TCAF2 n/a
7 TRCN0000127705 GCTCTCTCAATTCCAGGCTAT pLKO.1 675 CDS 100% 4.050 2.025 Y TCAF2 n/a
8 TRCN0000130547 CCTGGAAACATATCTACAGGT pLKO.1 1911 CDS 100% 2.640 1.320 Y TCAF2 n/a
9 TRCN0000127582 CCTGTAACCTTTGGTCAGTCT pLKO.1 1757 CDS 100% 2.640 1.320 Y TCAF2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001365428.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16152 pDONR223 0% 66.6% 66.6% None 0_1ins843;879A>T;931G>A n/a
2 ccsbBroad304_16152 pLX_304 0% 66.6% 66.6% V5 0_1ins843;879A>T;931G>A n/a
3 TRCN0000480415 AAGCACCTTCTTCCATCGTAACGT pLX_317 15.5% 66.6% 66.6% V5 0_1ins843;879A>T;931G>A n/a
Download CSV