Transcript: Human NM_001365792.1

Homo sapiens DAB adaptor protein 1 (DAB1), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
DAB1 (1600)
Length:
5301
CDS:
268..1935

Additional Resources:

NCBI RefSeq record:
NM_001365792.1
NBCI Gene record:
DAB1 (1600)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001365792.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063948 GCCAAATTGATCGGGATTGAT pLKO.1 397 CDS 100% 5.625 7.875 N DAB1 n/a
2 TRCN0000426631 GGAGCCCAGTGGTGATAATAT pLKO_005 1893 CDS 100% 15.000 12.000 N DAB1 n/a
3 TRCN0000435003 GTAAGTGCTGTGACCCAATTA pLKO_005 985 CDS 100% 13.200 9.240 N DAB1 n/a
4 TRCN0000063950 CGAGTGCAGATGTGTTTAGTT pLKO.1 1109 CDS 100% 5.625 3.938 N DAB1 n/a
5 TRCN0000063952 CTCATCCAACAGTGATCCATT pLKO.1 1857 CDS 100% 4.950 3.465 N DAB1 n/a
6 TRCN0000177311 GTTATGTCAAGATTCCATGAT pLKO.1 444 CDS 100% 4.950 3.465 N Dab1 n/a
7 TRCN0000063949 CCACACAAACTGTTATGCCTT pLKO.1 1370 CDS 100% 2.640 1.848 N DAB1 n/a
8 TRCN0000182621 GCAGTGTGAACAAGCTGTGTA pLKO.1 801 CDS 100% 4.950 2.970 N Dab1 n/a
9 TRCN0000063951 GCCACTTTGATAAAGAGGTTT pLKO.1 352 CDS 100% 4.950 2.970 N DAB1 n/a
10 TRCN0000177332 GCCACTTTGATAAAGAGGTTT pLKO.1 352 CDS 100% 4.950 2.970 N Dab1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001365792.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15394 pDONR223 0% 81.2% 73.8% None (many diffs) n/a
2 ccsbBroad304_15394 pLX_304 0% 81.2% 73.8% V5 (many diffs) n/a
Download CSV