Transcript: Human NM_001366264.1

Homo sapiens zinc finger and BTB domain containing 8 opposite strand (ZBTB8OS), transcript variant 17, mRNA.

Source:
NCBI, updated 2019-03-22
Taxon:
Homo sapiens (human)
Gene:
ZBTB8OS (339487)
Length:
1985
CDS:
368..943

Additional Resources:

NCBI RefSeq record:
NM_001366264.1
NBCI Gene record:
ZBTB8OS (339487)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001366264.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000131054 CCAAGTATCCGCCAGTCAATA pLKO.1 468 CDS 100% 13.200 9.240 N ZBTB8OS n/a
2 TRCN0000312431 CCAAGTATCCGCCAGTCAATA pLKO_005 468 CDS 100% 13.200 9.240 N ZBTB8OS n/a
3 TRCN0000130822 GATACTCTGGAGGAAGCATTT pLKO.1 542 CDS 100% 10.800 7.560 N ZBTB8OS n/a
4 TRCN0000349725 GATACTCTGGAGGAAGCATTT pLKO_005 542 CDS 100% 10.800 7.560 N ZBTB8OS n/a
5 TRCN0000130501 GCAATGCAGGTCTATAATGAA pLKO.1 887 CDS 100% 5.625 3.938 N ZBTB8OS n/a
6 TRCN0000312490 GCAATGCAGGTCTATAATGAA pLKO_005 887 CDS 100% 5.625 3.938 N ZBTB8OS n/a
7 TRCN0000129046 GACTTACAGTCTCTTCTGTTT pLKO.1 653 CDS 100% 4.950 3.465 N ZBTB8OS n/a
8 TRCN0000130861 GAAGTAGAAACCCAAGGAGAT pLKO.1 632 CDS 100% 4.050 2.835 N ZBTB8OS n/a
9 TRCN0000312489 GAAGTAGAAACCCAAGGAGAT pLKO_005 632 CDS 100% 4.050 2.835 N ZBTB8OS n/a
10 TRCN0000128050 GAAACCCAAGGAGATGACTTA pLKO.1 638 CDS 100% 4.950 2.970 N ZBTB8OS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001366264.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13588 pDONR223 100% 71.2% 59.4% None 1_36del;363_451del;534_573del n/a
2 ccsbBroad304_13588 pLX_304 0% 71.2% 59.4% V5 1_36del;363_451del;534_573del n/a
3 TRCN0000469966 TAAGGACCTGGCTTGGCCGCGGTA pLX_317 100% 71.2% 59.4% V5 1_36del;363_451del;534_573del n/a
Download CSV