Transcript: Human NM_001366308.1

Homo sapiens karyopherin subunit alpha 5 (KPNA5), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
KPNA5 (3841)
Length:
1918
CDS:
125..1582

Additional Resources:

NCBI RefSeq record:
NM_001366308.1
NBCI Gene record:
KPNA5 (3841)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001366308.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417281 CAGTTGTTCAAACGCAGAAAT pLKO_005 260 CDS 100% 13.200 18.480 N KPNA5 n/a
2 TRCN0000412758 GAGGTACTCCAGAGCAAATAA pLKO_005 1356 CDS 100% 15.000 10.500 N KPNA5 n/a
3 TRCN0000421243 AGAAGCAGCTTGGGCTATAAC pLKO_005 1321 CDS 100% 13.200 9.240 N KPNA5 n/a
4 TRCN0000064943 CCACCAATAGATCAAGTTATA pLKO.1 473 CDS 100% 13.200 9.240 N KPNA5 n/a
5 TRCN0000423556 CTATGCTTGAAAGTCCTATAC pLKO_005 306 CDS 100% 10.800 7.560 N KPNA5 n/a
6 TRCN0000064945 GCTCTCATTGAAGAAGCATAT pLKO.1 1535 CDS 100% 10.800 7.560 N KPNA5 n/a
7 TRCN0000064946 CCAGATATTAGTTCCACTGTA pLKO.1 332 CDS 100% 4.950 3.465 N KPNA5 n/a
8 TRCN0000064944 CCTCCAAACTTTAGTAAGGTT pLKO.1 863 CDS 100% 3.000 2.100 N KPNA5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001366308.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00914 pDONR223 100% 89.3% 88.6% None (many diffs) n/a
2 ccsbBroad304_00914 pLX_304 0% 89.3% 88.6% V5 (many diffs) n/a
3 TRCN0000465525 GGACTCATCTGGATCCTTTCTGTA pLX_317 21.1% 89.3% 88.6% V5 (many diffs) n/a
Download CSV