Transcript: Human NM_001366346.1

Homo sapiens androgen induced 1 (AIG1), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-08-11
Taxon:
Homo sapiens (human)
Gene:
AIG1 (51390)
Length:
2025
CDS:
38..787

Additional Resources:

NCBI RefSeq record:
NM_001366346.1
NBCI Gene record:
AIG1 (51390)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001366346.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000121552 CTGACGTTCATTGATCTGGTT pLKO.1 161 CDS 100% 2.640 3.696 N AIG1 n/a
2 TRCN0000423496 ACGACGGTTCTGCCCTTTATA pLKO_005 440 CDS 100% 15.000 12.000 N AIG1 n/a
3 TRCN0000422331 CAGTGTTCTGGATCATTTATG pLKO_005 345 CDS 100% 13.200 9.240 N AIG1 n/a
4 TRCN0000144770 CCTATGACAGAGAGATGATAT pLKO.1 366 CDS 100% 13.200 9.240 N AIG1 n/a
5 TRCN0000255762 CTATGACAGAGAGATGATATA pLKO_005 367 CDS 100% 13.200 9.240 N Aig1 n/a
6 TRCN0000438932 GGACATCGCACCATCAGTATC pLKO_005 474 CDS 100% 10.800 7.560 N AIG1 n/a
7 TRCN0000140828 GATGGCAATCCTGCTGTCTTA pLKO.1 67 CDS 100% 4.950 3.465 N AIG1 n/a
8 TRCN0000140597 GCTGGAAATTCCTGACGTTCA pLKO.1 150 CDS 100% 4.050 2.835 N AIG1 n/a
9 TRCN0000142987 CAGAGAGATGATATACCCGAA pLKO.1 373 CDS 100% 2.160 1.512 N AIG1 n/a
10 TRCN0000139226 CCTGTGTAACTACAAGGCCAT pLKO.1 97 CDS 100% 2.160 1.512 N AIG1 n/a
11 TRCN0000139776 CTGGTTATCCAGGCTGTCTTT pLKO.1 176 CDS 100% 4.950 2.970 N AIG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001366346.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03298 pDONR223 100% 91.8% 92.7% None (many diffs) n/a
2 ccsbBroad304_03298 pLX_304 0% 91.8% 92.7% V5 (many diffs) n/a
3 TRCN0000472812 GTGGTAAACTACAGTGAATACGAG pLX_317 45.7% 91.8% 92.7% V5 (many diffs) n/a
Download CSV