Transcript: Human NM_001366456.1

Homo sapiens RAB GTPase activating protein 1 like (RABGAP1L), transcript variant 20, mRNA.

Source:
NCBI, updated 2019-03-22
Taxon:
Homo sapiens (human)
Gene:
RABGAP1L (9910)
Length:
6817
CDS:
596..1510

Additional Resources:

NCBI RefSeq record:
NM_001366456.1
NBCI Gene record:
RABGAP1L (9910)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001366456.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000166364 CACACACACACACACACACAA pLKO.1 194 5UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001366456.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15682 pDONR223 0% 16.6% 14.7% None (many diffs) n/a
2 ccsbBroad304_15682 pLX_304 0% 16.6% 14.7% V5 (many diffs) n/a
3 TRCN0000473968 AATATCTGTCGGCCTTAAACCATG pLX_317 100% 15.8% 14.7% V5 (many diffs) n/a
Download CSV