Transcript: Human NM_001366466.2

Homo sapiens MDS1 and EVI1 complex locus (MECOM), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-08-25
Taxon:
Homo sapiens (human)
Gene:
MECOM (2122)
Length:
5435
CDS:
341..4033

Additional Resources:

NCBI RefSeq record:
NM_001366466.2
NBCI Gene record:
MECOM (2122)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001366466.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000002532 TGCAGGGTCACTCATCTAAAG pLKO.1 4134 3UTR 100% 10.800 15.120 N MECOM n/a
2 TRCN0000002529 GCACTACGTCTTCCTTAAATA pLKO.1 1584 CDS 100% 15.000 10.500 N MECOM n/a
3 TRCN0000234041 TTAACTGGAAGTCCAATTTAA pLKO_005 1239 CDS 100% 15.000 10.500 N Mecom n/a
4 TRCN0000002531 CCTTTCTTTATGGACCCTATT pLKO.1 2804 CDS 100% 10.800 7.560 N MECOM n/a
5 TRCN0000234043 CTCAATCAATGTACCCATTTC pLKO_005 2451 CDS 100% 10.800 7.560 N Mecom n/a
6 TRCN0000015584 CCACAAATAATGAGTGTGTAT pLKO.1 372 CDS 100% 4.950 3.465 N MECOM n/a
7 TRCN0000015585 CCCATCTACATCCCTGATGAT pLKO.1 539 CDS 100% 4.950 3.465 N MECOM n/a
8 TRCN0000015587 CCTTTGGAAGAAATGCCAGAT pLKO.1 413 CDS 100% 4.050 2.835 N MECOM n/a
9 TRCN0000002530 GCCGTTACACAGAAAGTCCAA pLKO.1 3871 CDS 100% 2.640 1.848 N MECOM n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001366466.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10811 pDONR223 100% 12.2% 10.6% None (many diffs) n/a
2 ccsbBroad304_10811 pLX_304 0% 12.2% 10.6% V5 (many diffs) n/a
3 TRCN0000474954 TCGCGCCCGGTTCGACTACGGGTG pLX_317 70.5% 12.2% 10.6% V5 (many diffs) n/a
Download CSV