Transcript: Human NM_001366909.1

Homo sapiens ciliary associated calcium binding coiled-coil 1 (CABCOCO1), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
CABCOCO1 (219621)
Length:
1764
CDS:
338..658

Additional Resources:

NCBI RefSeq record:
NM_001366909.1
NBCI Gene record:
CABCOCO1 (219621)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001366909.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263472 ACTACAAGCTATACGAGTTTA pLKO_005 564 CDS 100% 13.200 18.480 N CABCOCO1 n/a
2 TRCN0000168636 GCCAGGGAAGAAATTGTGATA pLKO.1 596 CDS 100% 4.950 3.465 N CABCOCO1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001366909.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09841 pDONR223 100% 49.3% 46.1% None (many diffs) n/a
2 ccsbBroad304_09841 pLX_304 0% 49.3% 46.1% V5 (many diffs) n/a
3 TRCN0000473759 CGTAGATGACCACACTACTATCTA pLX_317 85% 49.3% 46.1% V5 (many diffs) n/a
Download CSV